Incidental Mutation 'R7866:Filip1'
ID 607785
Institutional Source Beutler Lab
Gene Symbol Filip1
Ensembl Gene ENSMUSG00000034898
Gene Name filamin A interacting protein 1
Synonyms 5730485H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock # R7866 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 79815051-80012851 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 79818943 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 798 (V798A)
Ref Sequence ENSEMBL: ENSMUSP00000091329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093811] [ENSMUST00000172973]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000093811
AA Change: V798A

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091329
Gene: ENSMUSG00000034898
AA Change: V798A

DomainStartEndE-ValueType
Pfam:CortBP2 71 256 2.1e-64 PFAM
coiled coil region 258 540 N/A INTRINSIC
low complexity region 545 564 N/A INTRINSIC
low complexity region 579 592 N/A INTRINSIC
coiled coil region 625 778 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 1126 1140 N/A INTRINSIC
low complexity region 1168 1180 N/A INTRINSIC
low complexity region 1198 1214 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172740
Predicted Effect probably benign
Transcript: ENSMUST00000172973
SMART Domains Protein: ENSMUSP00000134427
Gene: ENSMUSG00000034898

DomainStartEndE-ValueType
Pfam:CortBP2 65 225 5.2e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a filamin A binding protein. The encoded protein promotes the degradation of filamin A and may regulate cortical neuron migration and dendritic spine morphology. Mice lacking a functional copy of this gene exhibit reduced dendritic spine length and altered excitatory signaling. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 C T 17: 31,098,295 R194* probably null Het
Actl6a A G 3: 32,712,113 T39A possibly damaging Het
Adamts6 T A 13: 104,413,749 C624* probably null Het
Adgrl1 T C 8: 83,937,935 probably null Het
Ap3m2 A G 8: 22,799,658 V143A probably benign Het
Ap5m1 T C 14: 49,073,761 V96A probably damaging Het
Aqp5 T A 15: 99,591,543 V91E probably damaging Het
Atp6v0b A T 4: 117,885,153 I181N probably damaging Het
Ccp110 T A 7: 118,723,018 M632K probably benign Het
Cd44 A T 2: 102,842,259 probably null Het
Cidea G A 18: 67,358,784 R38Q probably damaging Het
Cnn3 T C 3: 121,451,393 I86T probably benign Het
Col14a1 C A 15: 55,388,620 D557E unknown Het
Col6a6 T C 9: 105,689,561 Y2245C probably damaging Het
Dhrs4 A T 14: 55,487,635 N196Y probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dpep2 T C 8: 105,989,481 T267A Het
Dtx3l T A 16: 35,938,750 Q43L probably benign Het
Ednrb A G 14: 103,843,302 S59P probably benign Het
Eml4 A G 17: 83,450,697 T435A probably benign Het
Fam135b A T 15: 71,462,076 F1090I probably benign Het
Fnip1 T G 11: 54,465,402 probably benign Het
Gabrb2 C T 11: 42,487,223 Q89* probably null Het
Gm960 T A 19: 4,698,486 R61S unknown Het
Gtf2ird1 A T 5: 134,363,209 V882E probably benign Het
Gucy1a2 T A 9: 3,532,804 M1K probably null Het
Igkv10-96 T A 6: 68,632,041 D90V possibly damaging Het
Igkv4-54 G A 6: 69,631,756 R60C probably benign Het
Igkv7-33 G T 6: 70,058,863 A45D probably damaging Het
Klk1b22 A T 7: 44,112,744 I15F possibly damaging Het
Lamp3 T A 16: 19,699,740 D249V probably benign Het
Lrrfip2 T C 9: 111,193,081 V125A possibly damaging Het
Mprip G A 11: 59,752,930 R638H possibly damaging Het
Muc5ac A G 7: 141,795,852 M501V probably benign Het
Myo5a C T 9: 75,203,752 P1509S probably damaging Het
Ngdn A G 14: 55,021,097 Y63C probably damaging Het
Oit3 A G 10: 59,424,030 V517A probably benign Het
Olfr935 A T 9: 38,994,731 S235T not run Het
Pcdhb18 T A 18: 37,490,459 F281I probably damaging Het
Pkd1 C A 17: 24,590,907 Q3520K probably benign Het
Plxnb1 T A 9: 109,100,457 I127N probably damaging Het
Ppfia2 A T 10: 106,819,529 N319I probably damaging Het
Pxn T C 5: 115,548,606 S386P possibly damaging Het
Ralgps2 C T 1: 156,887,168 V104I probably benign Het
Rp1 C T 1: 4,347,701 V1063I probably benign Het
Slc10a5 A T 3: 10,334,472 F376Y probably damaging Het
Snd1 T A 6: 28,527,725 I277N probably damaging Het
Spc25 A G 2: 69,206,062 probably null Het
Tex29 A G 8: 11,844,055 N6D unknown Het
Ttc30b A G 2: 75,936,619 S597P possibly damaging Het
Ttc6 G A 12: 57,674,649 A975T probably damaging Het
Uba6 T C 5: 86,172,701 E13G probably damaging Het
Ugcg T G 4: 59,211,927 C98G possibly damaging Het
Ugt2b36 T A 5: 87,092,331 D65V probably damaging Het
Unc93b1 A T 19: 3,935,243 D17V not run Het
Usf1 G T 1: 171,417,894 W291C unknown Het
Vps29 T C 5: 122,362,117 W97R possibly damaging Het
Zbtb6 T C 2: 37,429,565 E117G probably damaging Het
Zfp735 A C 11: 73,710,803 D191A probably benign Het
Other mutations in Filip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Filip1 APN 9 79817944 missense probably damaging 1.00
IGL01101:Filip1 APN 9 79898246 missense probably benign 0.44
IGL01301:Filip1 APN 9 79819180 missense possibly damaging 0.93
IGL01887:Filip1 APN 9 79819617 missense probably benign 0.42
IGL02119:Filip1 APN 9 79818266 missense probably benign
IGL02285:Filip1 APN 9 79820126 missense probably damaging 1.00
IGL02395:Filip1 APN 9 79898410 missense probably benign 0.01
IGL03398:Filip1 APN 9 79818943 missense probably benign 0.03
IGL03400:Filip1 APN 9 79820473 missense probably benign 0.01
IGL03404:Filip1 APN 9 79818559 missense probably damaging 0.99
ANU18:Filip1 UTSW 9 79819180 missense possibly damaging 0.93
BB010:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
BB020:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R0101:Filip1 UTSW 9 79819528 missense probably benign 0.04
R0243:Filip1 UTSW 9 79819003 missense probably damaging 0.98
R0244:Filip1 UTSW 9 79819462 missense possibly damaging 0.87
R0371:Filip1 UTSW 9 79860091 missense probably damaging 1.00
R0399:Filip1 UTSW 9 79818310 missense possibly damaging 0.71
R0412:Filip1 UTSW 9 79820289 missense possibly damaging 0.59
R0671:Filip1 UTSW 9 79819390 missense probably damaging 1.00
R1314:Filip1 UTSW 9 79820566 missense probably damaging 1.00
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1465:Filip1 UTSW 9 79898307 missense probably benign 0.25
R1602:Filip1 UTSW 9 79820591 missense probably damaging 0.99
R1801:Filip1 UTSW 9 79815846 missense probably damaging 0.98
R1929:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R1983:Filip1 UTSW 9 79860092 missense probably damaging 1.00
R2066:Filip1 UTSW 9 79820216 missense probably damaging 1.00
R2128:Filip1 UTSW 9 79819330 missense probably damaging 0.99
R2271:Filip1 UTSW 9 79819930 missense probably damaging 1.00
R2411:Filip1 UTSW 9 79898433 missense probably damaging 0.98
R3429:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3430:Filip1 UTSW 9 79853670 missense probably damaging 1.00
R3945:Filip1 UTSW 9 79818367 missense probably benign 0.01
R4007:Filip1 UTSW 9 79818727 missense possibly damaging 0.71
R4583:Filip1 UTSW 9 79815809 missense possibly damaging 0.76
R4803:Filip1 UTSW 9 79820114 missense probably benign 0.05
R4837:Filip1 UTSW 9 79819459 missense probably damaging 0.98
R4910:Filip1 UTSW 9 79817932 missense probably benign 0.00
R4929:Filip1 UTSW 9 79819747 missense probably benign 0.07
R5387:Filip1 UTSW 9 79818274 missense probably benign
R5581:Filip1 UTSW 9 79819760 missense possibly damaging 0.95
R5808:Filip1 UTSW 9 79818701 missense possibly damaging 0.67
R5891:Filip1 UTSW 9 79819860 missense possibly damaging 0.69
R6166:Filip1 UTSW 9 79819454 missense probably damaging 0.99
R6273:Filip1 UTSW 9 79815886 missense probably benign 0.01
R6380:Filip1 UTSW 9 79819624 missense probably damaging 0.99
R6385:Filip1 UTSW 9 79820531 missense possibly damaging 0.68
R6614:Filip1 UTSW 9 79815839 missense probably damaging 1.00
R6715:Filip1 UTSW 9 79818758 missense probably benign 0.03
R7047:Filip1 UTSW 9 79853634 missense probably damaging 0.98
R7126:Filip1 UTSW 9 79898295 missense possibly damaging 0.88
R7144:Filip1 UTSW 9 79820213 missense possibly damaging 0.65
R7218:Filip1 UTSW 9 79818074 missense probably benign
R7404:Filip1 UTSW 9 79820098 missense possibly damaging 0.94
R7702:Filip1 UTSW 9 79820649 missense probably benign 0.20
R7933:Filip1 UTSW 9 79820047 missense possibly damaging 0.65
R8012:Filip1 UTSW 9 79817959 missense probably damaging 0.97
R8097:Filip1 UTSW 9 79818259 missense probably benign
R8213:Filip1 UTSW 9 79818092 missense probably benign 0.01
R8305:Filip1 UTSW 9 79820475 nonsense probably null
R8798:Filip1 UTSW 9 79820090 missense possibly damaging 0.94
R9184:Filip1 UTSW 9 79898260 missense probably benign 0.03
R9322:Filip1 UTSW 9 79819732 missense probably benign 0.01
R9334:Filip1 UTSW 9 79818457 missense probably benign 0.32
R9353:Filip1 UTSW 9 79818341 missense possibly damaging 0.67
R9541:Filip1 UTSW 9 79819853 nonsense probably null
R9607:Filip1 UTSW 9 79819120 missense probably damaging 1.00
X0054:Filip1 UTSW 9 79819535 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAAGACTTCCTCATGGTGAG -3'
(R):5'- TGAACAAGGAAGATCAGCTCTCTC -3'

Sequencing Primer
(F):5'- AAGACTTCCTCATGGTGAGTTCATTG -3'
(R):5'- CAGCTCCAGGTCGACTATTCGG -3'
Posted On 2019-12-20