Incidental Mutation 'R9278:Ddx60'
ID 703437
Institutional Source Beutler Lab
Gene Symbol Ddx60
Ensembl Gene ENSMUSG00000037921
Gene Name DEAD (Asp-Glu-Ala-Asp) box polypeptide 60
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock # R9278 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 61928087-62038244 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 61977978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 849 (Y849F)
Ref Sequence ENSEMBL: ENSMUSP00000091197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070631] [ENSMUST00000093485]
AlphaFold E9PZQ1
Predicted Effect possibly damaging
Transcript: ENSMUST00000070631
AA Change: Y848F

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070741
Gene: ENSMUSG00000037921
AA Change: Y848F

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 758 949 1.05e-15 SMART
Blast:DEXDc 1007 1132 4e-24 BLAST
HELICc 1245 1328 4.35e-13 SMART
low complexity region 1362 1373 N/A INTRINSIC
Blast:DEXDc 1503 1584 1e-20 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000093485
AA Change: Y849F

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091197
Gene: ENSMUSG00000037921
AA Change: Y849F

DomainStartEndE-ValueType
low complexity region 99 110 N/A INTRINSIC
low complexity region 364 376 N/A INTRINSIC
DEXDc 759 950 1.05e-15 SMART
Blast:DEXDc 1008 1133 4e-24 BLAST
HELICc 1246 1329 4.35e-13 SMART
low complexity region 1363 1374 N/A INTRINSIC
Blast:DEXDc 1504 1585 1e-20 BLAST
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 93.4%
  • 10x: 93.2%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal immunity to several viruses (IAV, EMCV, SINV) but increased susceptibility to VSV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,804,008 C59S probably damaging Het
Aicda C T 6: 122,561,895 A161V possibly damaging Het
Ankrd12 C T 17: 66,037,604 E91K possibly damaging Het
Arpc2 C A 1: 74,236,882 F19L probably benign Het
Aspa T C 11: 73,324,454 K12E possibly damaging Het
Chd8 G A 14: 52,235,170 P392L probably benign Het
Cldn10 C T 14: 118,874,235 R206W probably damaging Het
Clec4b2 T A 6: 123,204,265 M203K probably damaging Het
Clec4d T C 6: 123,274,690 M177T probably benign Het
Clec4d G T 6: 123,274,692 E178* probably null Het
Cmpk2 A T 12: 26,469,569 Y73F probably benign Het
Col1a1 T A 11: 94,947,277 V845D unknown Het
Cyp2c67 C T 19: 39,609,255 R433Q probably damaging Het
Dda1 A T 8: 71,474,486 probably null Het
Dnm2 C T 9: 21,505,681 R837W possibly damaging Het
Dtwd1 C T 2: 126,164,808 T250I probably damaging Het
Efcab6 A G 15: 83,892,893 V1114A probably damaging Het
Fat4 A G 3: 38,891,022 T1355A probably benign Het
Fbxo40 T G 16: 36,969,578 D390A possibly damaging Het
Gm7534 A G 4: 134,195,459 L521P probably damaging Het
Gnaz T A 10: 74,991,605 L63Q probably benign Het
H6pd T A 4: 149,995,850 K179N probably damaging Het
Hps5 A G 7: 46,790,973 F18L probably benign Het
Hyal5 A G 6: 24,876,695 E189G probably benign Het
Ifnar1 T A 16: 91,505,125 I496N probably damaging Het
Igf2r C A 17: 12,695,353 C1743F probably damaging Het
Igfn1 C A 1: 135,973,447 R431L probably damaging Het
Itch A G 2: 155,203,297 Q507R probably benign Het
Kbtbd2 C A 6: 56,780,346 R135L probably damaging Het
Kcnn2 T C 18: 45,592,379 I314T probably damaging Het
Lix1 A G 17: 17,402,949 D2G probably damaging Het
Lrp1b T C 2: 40,597,064 Y4557C Het
Ltbp2 G A 12: 84,791,090 P1192L probably benign Het
Med19 G T 2: 84,678,631 G63C probably damaging Het
Mfsd4b1 C T 10: 40,007,334 R40H probably damaging Het
Neb C T 2: 52,256,178 R2929H probably damaging Het
Nlrc5 A G 8: 94,511,280 D1434G probably benign Het
Nlrp14 A T 7: 107,197,842 N972I probably damaging Het
Olfr1247 A C 2: 89,609,604 F166C probably damaging Het
Olfr128 A T 17: 37,924,384 M273L probably benign Het
Olfr132 A T 17: 38,130,802 L130Q probably damaging Het
Olfr46 T C 7: 140,611,023 Y278H probably damaging Het
Olfr947-ps1 A G 9: 39,289,485 V135A probably benign Het
Otop1 T C 5: 38,302,815 V575A probably damaging Het
Pcdhb4 A G 18: 37,308,872 S412G possibly damaging Het
Pcsk4 T C 10: 80,325,390 D230G probably damaging Het
Phldb2 C A 16: 45,825,945 S46I probably damaging Het
Pik3ca A T 3: 32,454,438 N785I probably damaging Het
Polr2b A G 5: 77,323,638 R274G probably damaging Het
Prkdc G A 16: 15,816,659 probably null Het
Prune2 C T 19: 17,123,780 T2216I probably benign Het
Psma3 A T 12: 70,994,382 D252V probably benign Het
Rnf213 T C 11: 119,435,942 V1586A Het
Ryr2 T C 13: 11,883,090 T140A probably benign Het
Slc25a48 A G 13: 56,463,739 I220V probably benign Het
Slc2a1 A T 4: 119,133,410 E246D probably benign Het
Slc45a4 A G 15: 73,586,357 Y448H probably benign Het
Sorl1 C T 9: 42,046,561 V596I probably benign Het
Spag6 A C 2: 18,699,174 E11A probably benign Het
Spef2 A G 15: 9,727,409 probably null Het
Spon1 T C 7: 114,028,953 S315P probably damaging Het
Stard3 G A 11: 98,372,105 probably benign Het
Sv2c A G 13: 95,976,081 M636T probably damaging Het
Syt17 T A 7: 118,434,257 D172V probably damaging Het
Tcf4 A G 18: 69,633,581 Y206C probably damaging Het
Tead2 G T 7: 45,231,352 S318I probably benign Het
Tom1 A T 8: 75,057,255 D289V probably damaging Het
Tsen15 T C 1: 152,383,347 I87V probably damaging Het
Ttc30a2 T C 2: 75,977,031 D379G probably damaging Het
Usp15 A G 10: 123,171,207 F123S probably damaging Het
Vmn1r220 A T 13: 23,184,088 I146N possibly damaging Het
Vmn2r108 A T 17: 20,472,299 N98K probably benign Het
Vmn2r71 T A 7: 85,620,580 M433K probably benign Het
Vmn2r97 A T 17: 18,914,500 H60L probably benign Het
Wbp4 A G 14: 79,462,046 V336A probably benign Het
Zfp663 T C 2: 165,360,090 probably null Het
Other mutations in Ddx60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ddx60 APN 8 61958646 missense probably damaging 1.00
IGL00915:Ddx60 APN 8 61987431 missense possibly damaging 0.79
IGL00931:Ddx60 APN 8 61969583 missense probably benign 0.18
IGL01023:Ddx60 APN 8 61942514 missense probably damaging 0.99
IGL01313:Ddx60 APN 8 61982526 missense probably damaging 1.00
IGL01615:Ddx60 APN 8 61963740 missense probably null 0.81
IGL01733:Ddx60 APN 8 61983865 missense probably damaging 0.99
IGL01779:Ddx60 APN 8 62017823 missense possibly damaging 0.94
IGL01900:Ddx60 APN 8 62000709 splice site probably benign
IGL02110:Ddx60 APN 8 62017247 critical splice donor site probably null
IGL02302:Ddx60 APN 8 61975832 missense possibly damaging 0.85
IGL02468:Ddx60 APN 8 61958642 missense probably damaging 1.00
IGL02569:Ddx60 APN 8 62024951 missense possibly damaging 0.93
IGL02622:Ddx60 APN 8 61942436 splice site probably null
IGL02657:Ddx60 APN 8 61984115 missense probably benign 0.01
IGL02677:Ddx60 APN 8 61988132 missense probably damaging 1.00
IGL02701:Ddx60 APN 8 61979341 missense probably damaging 0.96
IGL02806:Ddx60 APN 8 61956122 missense probably benign 0.00
IGL03137:Ddx60 APN 8 61988083 missense possibly damaging 0.61
IGL03295:Ddx60 APN 8 61956121 missense possibly damaging 0.82
IGL03387:Ddx60 APN 8 62012449 missense probably damaging 1.00
IGL03411:Ddx60 APN 8 61977882 critical splice acceptor site probably null
Scatter UTSW 8 62021314 missense possibly damaging 0.80
shotgun UTSW 8 62037067 missense probably benign 0.28
splay UTSW 8 62021309 missense possibly damaging 0.80
G1Funyon:Ddx60 UTSW 8 62000597 missense probably benign 0.01
PIT4504001:Ddx60 UTSW 8 61958113 missense probably benign
PIT4677001:Ddx60 UTSW 8 61972254 missense possibly damaging 0.87
R0090:Ddx60 UTSW 8 61942293 missense probably damaging 1.00
R0266:Ddx60 UTSW 8 62033493 missense possibly damaging 0.92
R0325:Ddx60 UTSW 8 61983855 missense probably benign 0.00
R0367:Ddx60 UTSW 8 62017749 missense possibly damaging 0.78
R0403:Ddx60 UTSW 8 61994541 splice site probably benign
R0479:Ddx60 UTSW 8 61969657 missense probably damaging 1.00
R0561:Ddx60 UTSW 8 62017794 missense possibly damaging 0.93
R0844:Ddx60 UTSW 8 61987361 missense probably benign 0.27
R1119:Ddx60 UTSW 8 61942544 missense probably damaging 1.00
R1428:Ddx60 UTSW 8 61958159 splice site probably benign
R1778:Ddx60 UTSW 8 61974176 missense possibly damaging 0.85
R1840:Ddx60 UTSW 8 61969553 missense probably damaging 0.99
R1964:Ddx60 UTSW 8 61948869 missense probably benign 0.10
R1970:Ddx60 UTSW 8 61972206 missense possibly damaging 0.93
R2101:Ddx60 UTSW 8 61940645 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 61956141 missense probably damaging 1.00
R2174:Ddx60 UTSW 8 62017200 missense probably benign 0.01
R2198:Ddx60 UTSW 8 61958063 missense possibly damaging 0.79
R2332:Ddx60 UTSW 8 62037091 missense probably benign 0.08
R2338:Ddx60 UTSW 8 62012436 missense possibly damaging 0.91
R2379:Ddx60 UTSW 8 62037088 missense probably damaging 1.00
R4010:Ddx60 UTSW 8 61954535 missense possibly damaging 0.65
R4010:Ddx60 UTSW 8 61956144 missense probably benign 0.25
R4133:Ddx60 UTSW 8 61972220 missense probably damaging 0.99
R4282:Ddx60 UTSW 8 61994393 missense probably damaging 0.99
R4382:Ddx60 UTSW 8 61948978 splice site probably null
R4561:Ddx60 UTSW 8 61942461 missense probably damaging 0.96
R4572:Ddx60 UTSW 8 61987421 missense probably damaging 1.00
R4581:Ddx60 UTSW 8 62023261 missense possibly damaging 0.90
R4635:Ddx60 UTSW 8 62037067 missense probably benign 0.28
R4698:Ddx60 UTSW 8 62012424 missense probably benign 0.01
R4807:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R4858:Ddx60 UTSW 8 62021314 missense possibly damaging 0.80
R4964:Ddx60 UTSW 8 61979338 missense probably damaging 1.00
R5120:Ddx60 UTSW 8 61945906 missense probably benign 0.01
R5187:Ddx60 UTSW 8 61974188 missense probably damaging 1.00
R5222:Ddx60 UTSW 8 61984158 missense probably damaging 0.99
R5400:Ddx60 UTSW 8 62010002 missense possibly damaging 0.65
R5500:Ddx60 UTSW 8 61950451 missense probably benign 0.28
R5514:Ddx60 UTSW 8 61958057 missense probably damaging 1.00
R5668:Ddx60 UTSW 8 62000578 missense probably benign 0.38
R5742:Ddx60 UTSW 8 61948921 missense probably benign
R5772:Ddx60 UTSW 8 61948897 missense probably damaging 1.00
R5810:Ddx60 UTSW 8 62012388 nonsense probably null
R5815:Ddx60 UTSW 8 61963722 missense probably damaging 0.98
R5820:Ddx60 UTSW 8 61956121 missense possibly damaging 0.82
R5866:Ddx60 UTSW 8 61940740 missense probably damaging 1.00
R5881:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R5977:Ddx60 UTSW 8 62021410 critical splice donor site probably null
R6048:Ddx60 UTSW 8 62000582 missense probably benign 0.01
R6061:Ddx60 UTSW 8 62023241 missense probably null 0.01
R6153:Ddx60 UTSW 8 61945940 missense possibly damaging 0.47
R6287:Ddx60 UTSW 8 61950578 missense probably damaging 1.00
R6415:Ddx60 UTSW 8 61983905 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61977950 missense probably benign 0.00
R6416:Ddx60 UTSW 8 61998681 missense probably benign
R6660:Ddx60 UTSW 8 61956239 missense probably benign 0.00
R6694:Ddx60 UTSW 8 62037070 missense probably damaging 1.00
R6715:Ddx60 UTSW 8 61983890 missense probably benign 0.03
R6720:Ddx60 UTSW 8 62000689 missense probably benign 0.10
R6937:Ddx60 UTSW 8 62037069 missense probably damaging 1.00
R7153:Ddx60 UTSW 8 61988108 missense possibly damaging 0.71
R7274:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R7409:Ddx60 UTSW 8 61958578 missense probably benign 0.24
R7464:Ddx60 UTSW 8 61940674 missense possibly damaging 0.82
R7670:Ddx60 UTSW 8 61975792 missense probably damaging 1.00
R7904:Ddx60 UTSW 8 61977890 missense possibly damaging 0.81
R7992:Ddx60 UTSW 8 61954535 missense probably benign 0.03
R8124:Ddx60 UTSW 8 61983911 missense probably benign
R8125:Ddx60 UTSW 8 61983911 missense probably benign
R8126:Ddx60 UTSW 8 61983911 missense probably benign
R8155:Ddx60 UTSW 8 62017171 missense possibly damaging 0.61
R8174:Ddx60 UTSW 8 62017250 splice site probably null
R8192:Ddx60 UTSW 8 61977968 missense probably damaging 1.00
R8271:Ddx60 UTSW 8 61940108 critical splice donor site probably null
R8301:Ddx60 UTSW 8 62000597 missense probably benign 0.01
R8304:Ddx60 UTSW 8 61998769 missense possibly damaging 0.67
R8319:Ddx60 UTSW 8 61942635 critical splice donor site probably null
R8374:Ddx60 UTSW 8 61974171 missense probably benign 0.01
R8401:Ddx60 UTSW 8 61956243 missense possibly damaging 0.57
R8487:Ddx60 UTSW 8 61974150 missense probably damaging 1.00
R8804:Ddx60 UTSW 8 61958606 missense probably benign 0.27
R8826:Ddx60 UTSW 8 61945956 missense probably benign 0.02
R8829:Ddx60 UTSW 8 61940661 missense probably damaging 1.00
R8881:Ddx60 UTSW 8 62021309 missense possibly damaging 0.80
R8884:Ddx60 UTSW 8 61994519 missense possibly damaging 0.86
R8990:Ddx60 UTSW 8 61974134 nonsense probably null
R9122:Ddx60 UTSW 8 61989864 missense probably benign 0.16
R9225:Ddx60 UTSW 8 62017841 missense probably benign 0.36
R9293:Ddx60 UTSW 8 62009960 missense possibly damaging 0.89
R9405:Ddx60 UTSW 8 61972214 missense probably benign 0.03
X0003:Ddx60 UTSW 8 62033417 missense possibly damaging 0.88
X0019:Ddx60 UTSW 8 61963692 missense probably benign 0.01
Z1177:Ddx60 UTSW 8 62000588 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGACATATCTTCTCTCATACTTGGATC -3'
(R):5'- CAGAAAATGACCTTGATTTATCACG -3'

Sequencing Primer
(F):5'- CTGGAATTCACTCTGTAGACCAGG -3'
(R):5'- GACCTTGATTTATCACGTTCTTTAAC -3'
Posted On 2022-03-25