Mutagenetix > Incidental Mutation

Incidental Mutation 'R2927:Dsc2'

255807

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2927 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20045501 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 282 (Y282C)

Ref Sequence

ENSEMBL: ENSMUSP00000074702 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably damaging
Transcript: ENSMUST00000039247
AA Change: Y282C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: Y282C

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000075214
AA Change: Y282C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: Y282C

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 20 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Cd109	CATTTATTTATTTATTTATTTATTTATTTATTTAT	CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT	9: 78,712,500		probably benign	Het
Dsg1b	C	A	18: 20,405,251	P638Q	probably benign	Het
Eea1	C	T	10: 96,013,358	S486L	probably benign	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ift22	A	G	5: 136,912,945	D147G	probably damaging	Het
Igsf10	T	A	3: 59,329,427	Q1111L	probably benign	Het
Ikzf1	T	C	11: 11,769,324	Y344H	probably damaging	Het
Kif1c	T	A	11: 70,726,314	C813S	probably benign	Het
Krt16	A	G	11: 100,248,799	L31P	unknown	Het
Lrrc49	G	A	9: 60,593,746	R633*	probably null	Het
Mllt6	T	A	11: 97,680,776	F1080I	probably damaging	Het
Olfr608	A	G	7: 103,470,882	Y281C	probably damaging	Het
Plxnc1	T	G	10: 94,793,292		probably null	Het
Ppp4r2	T	C	6: 100,861,465	Y115H	probably damaging	Het
Pramel1	T	A	4: 143,398,818	D437E	probably benign	Het
Pstpip2	C	A	18: 77,861,889	Q133K	probably damaging	Het
Ptgs2	A	T	1: 150,101,260	T41S	possibly damaging	Het
Slc36a1	G	A	11: 55,232,375	A389T	probably damaging	Het
Vav2	A	G	2: 27,426,391	V30A	probably damaging	Het
Vmn1r119	C	T	7: 21,012,131	V109I	probably benign	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCCAGCTGAGACACTATG -3'
(R):5'- GTTAAAGTAAGCACAGGCATGC -3'

Sequencing Primer
(F):5'- GCTGAGACACTATGCTCTTAAAAGC -3'
(R):5'- TGTGATCCTGCTCTGTCAAAAG -3'

Posted On

2014-12-29