Incidental Mutation 'R9396:Dsc2'
ID 710862
Institutional Source Beutler Lab
Gene Symbol Dsc2
Ensembl Gene ENSMUSG00000024331
Gene Name desmocollin 2
Synonyms Dsc2b, Dsc2a
Accession Numbers

Genbank: NM_013505; MGI: 103221

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9396 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 20030633-20059554 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 20041716 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 501 (R501*)
Ref Sequence ENSEMBL: ENSMUSP00000042905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]
AlphaFold P55292
Predicted Effect probably null
Transcript: ENSMUST00000039247
AA Change: R501*
SMART Domains Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: R501*

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075214
AA Change: R501*
SMART Domains Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: R501*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Cadherin_pro 31 113 2.82e-37 SMART
CA 156 241 4.66e-11 SMART
CA 265 353 1.87e-24 SMART
low complexity region 358 372 N/A INTRINSIC
CA 376 470 1.27e-12 SMART
CA 493 575 4.14e-17 SMART
CA 594 676 1.49e-1 SMART
transmembrane domain 696 718 N/A INTRINSIC
Pfam:Cadherin_C 730 901 3.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128464
SMART Domains Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
Cadherin_pro 31 113 2.82e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155407
SMART Domains Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

DomainStartEndE-ValueType
SCOP:d1l3wa5 2 71 2e-3 SMART
Blast:CA 2 76 2e-47 BLAST
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 T A 17: 84,692,854 F281I probably damaging Het
Acad8 A G 9: 26,975,745 M402T probably damaging Het
Apcdd1 C T 18: 62,922,660 probably benign Het
Apol7a T C 15: 77,389,725 E179G possibly damaging Het
Asmt A G X: 170,676,406 T217A probably benign Het
Cadm2 T C 16: 66,747,216 Y318C probably damaging Het
Cckar G A 5: 53,707,281 T26M probably damaging Het
Cd300ld G A 11: 114,987,404 T94I probably damaging Het
Cdk5rap2 C T 4: 70,264,658 S1268N probably damaging Het
Cdk5rap2 A G 4: 70,254,666 Y1390H possibly damaging Het
Csrnp3 C T 2: 66,002,497 R127C probably damaging Het
Dusp2 C T 2: 127,337,718 R294C probably damaging Het
Edrf1 A G 7: 133,660,109 K878E possibly damaging Het
Evc T C 5: 37,319,090 T372A possibly damaging Het
Fam205c TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG 4: 42,871,823 probably benign Het
Fcgr1 T A 3: 96,287,074 K166* probably null Het
Fstl4 C A 11: 52,773,951 P36Q probably benign Het
Gas2l2 A T 11: 83,422,833 I551N probably benign Het
Hc G T 2: 35,037,603 S333* probably null Het
Ibsp A G 5: 104,310,431 Y278C probably damaging Het
Ifitm10 A T 7: 142,370,967 V45D probably damaging Het
Kcnc3 T C 7: 44,591,513 S210P possibly damaging Het
Klhl3 T G 13: 58,013,848 T531P probably damaging Het
Mapt C A 11: 104,298,729 P191Q possibly damaging Het
Mpp5 G T 12: 78,824,747 R367L possibly damaging Het
Myh9 T C 15: 77,763,296 T1840A probably benign Het
Myof A T 19: 37,934,846 C1320S probably damaging Het
Myom3 G T 4: 135,785,888 V626L probably benign Het
Ndor1 A G 2: 25,248,909 L321P probably benign Het
Nhsl1 T A 10: 18,524,001 M291K probably damaging Het
Nubp2 C T 17: 24,884,502 V134I probably benign Het
Nuf2 T C 1: 169,510,348 I287V probably benign Het
Olfr1066 A T 2: 86,455,501 C257S probably benign Het
Olfr1290 A G 2: 111,489,519 L213P probably benign Het
Olfr134 T A 17: 38,175,530 W149R probably damaging Het
Olfr195 G A 16: 59,148,939 V30M probably damaging Het
Olfr412 T A 11: 74,365,263 M198K probably benign Het
Olfr544 A C 7: 102,484,973 V49G possibly damaging Het
Olfr641 A G 7: 104,040,513 N239S probably benign Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Ppp1r12a A G 10: 108,264,710 E863G probably damaging Het
Pskh1 C T 8: 105,913,459 T257M possibly damaging Het
Rasgef1b T C 5: 99,229,329 I334V probably benign Het
Rnf180 T A 13: 105,181,519 K462* probably null Het
Sin3a A G 9: 57,101,161 D455G probably benign Het
Slc15a4 A G 5: 127,617,399 probably benign Het
Slc2a13 T C 15: 91,343,712 T426A probably benign Het
Smarca5 T C 8: 80,736,729 K70R probably benign Het
Smg1 A G 7: 118,208,080 V182A unknown Het
Stim1 G A 7: 102,415,385 V221I possibly damaging Het
Tbx18 T C 9: 87,727,379 D201G probably damaging Het
Tcf25 A G 8: 123,401,092 E630G probably benign Het
Tm7sf3 T C 6: 146,621,974 N135S possibly damaging Het
Tmem28 C T X: 99,845,491 R321W probably damaging Het
Togaram1 A G 12: 64,967,655 N560S probably damaging Het
Unc13d A G 11: 116,075,703 probably null Het
Zfp445 A C 9: 122,852,516 S787A probably benign Het
Zfp949 T C 9: 88,567,207 W22R probably damaging Het
Other mutations in Dsc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Dsc2 APN 18 20041797 missense probably benign 0.01
IGL00826:Dsc2 APN 18 20035315 missense probably damaging 1.00
IGL00852:Dsc2 APN 18 20034683 missense probably benign 0.01
IGL01082:Dsc2 APN 18 20043792 missense probably damaging 1.00
IGL01328:Dsc2 APN 18 20048286 missense probably damaging 0.98
IGL01338:Dsc2 APN 18 20047157 missense probably benign 0.19
IGL01727:Dsc2 APN 18 20038200 missense probably benign 0.01
IGL01766:Dsc2 APN 18 20046342 missense possibly damaging 0.56
IGL02228:Dsc2 APN 18 20043733 missense probably damaging 0.99
IGL02560:Dsc2 APN 18 20045539 missense probably damaging 1.00
IGL02794:Dsc2 APN 18 20041731 missense probably damaging 1.00
3-1:Dsc2 UTSW 18 20047079 missense possibly damaging 0.60
PIT4305001:Dsc2 UTSW 18 20046243 missense probably damaging 0.96
PIT4431001:Dsc2 UTSW 18 20046277 nonsense probably null
R0288:Dsc2 UTSW 18 20033120 missense probably damaging 1.00
R0542:Dsc2 UTSW 18 20051226 missense probably damaging 0.99
R0562:Dsc2 UTSW 18 20041537 missense probably damaging 0.99
R0697:Dsc2 UTSW 18 20041452 missense probably damaging 0.99
R0940:Dsc2 UTSW 18 20050059 missense probably damaging 0.97
R1081:Dsc2 UTSW 18 20033295 missense probably damaging 0.96
R1140:Dsc2 UTSW 18 20032212 missense probably damaging 1.00
R1515:Dsc2 UTSW 18 20034701 missense probably damaging 0.99
R1515:Dsc2 UTSW 18 20045565 missense probably benign 0.40
R1558:Dsc2 UTSW 18 20050151 missense probably damaging 0.99
R1654:Dsc2 UTSW 18 20046246 missense probably benign 0.01
R2061:Dsc2 UTSW 18 20032399 missense possibly damaging 0.79
R2089:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2091:Dsc2 UTSW 18 20033294 missense possibly damaging 0.65
R2172:Dsc2 UTSW 18 20045502 missense probably damaging 1.00
R2247:Dsc2 UTSW 18 20035312 missense probably damaging 1.00
R2472:Dsc2 UTSW 18 20045469 missense probably benign 0.00
R2927:Dsc2 UTSW 18 20045501 missense probably damaging 1.00
R3611:Dsc2 UTSW 18 20032351 missense probably damaging 0.99
R3961:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R3963:Dsc2 UTSW 18 20051227 missense probably damaging 0.98
R4353:Dsc2 UTSW 18 20050068 missense probably damaging 1.00
R4362:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R4612:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4613:Dsc2 UTSW 18 20041819 missense probably damaging 1.00
R4752:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R4946:Dsc2 UTSW 18 20050157 missense probably damaging 1.00
R5056:Dsc2 UTSW 18 20050142 missense probably damaging 1.00
R5267:Dsc2 UTSW 18 20034583 critical splice donor site probably null
R5445:Dsc2 UTSW 18 20035303 missense possibly damaging 0.76
R5507:Dsc2 UTSW 18 20046279 missense probably damaging 0.96
R5575:Dsc2 UTSW 18 20035390 missense probably damaging 1.00
R5781:Dsc2 UTSW 18 20032510 missense probably benign 0.00
R6102:Dsc2 UTSW 18 20047108 missense probably benign 0.01
R6129:Dsc2 UTSW 18 20045430 missense possibly damaging 0.95
R6362:Dsc2 UTSW 18 20035463 nonsense probably null
R6433:Dsc2 UTSW 18 20051175 critical splice donor site probably null
R6513:Dsc2 UTSW 18 20046238 missense probably benign
R6615:Dsc2 UTSW 18 20032519 missense possibly damaging 0.88
R6619:Dsc2 UTSW 18 20032278 missense probably benign 0.22
R6665:Dsc2 UTSW 18 20050148 missense probably damaging 1.00
R6961:Dsc2 UTSW 18 20038222 missense probably damaging 1.00
R7179:Dsc2 UTSW 18 20035275 critical splice donor site probably null
R7275:Dsc2 UTSW 18 20051179 nonsense probably null
R7352:Dsc2 UTSW 18 20035335 missense probably benign 0.39
R7386:Dsc2 UTSW 18 20041926 missense possibly damaging 0.84
R7496:Dsc2 UTSW 18 20035394 nonsense probably null
R7510:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R7580:Dsc2 UTSW 18 20050073 missense probably damaging 1.00
R7718:Dsc2 UTSW 18 20041778 missense probably damaging 0.98
R7733:Dsc2 UTSW 18 20048315 missense probably benign 0.00
R7733:Dsc2 UTSW 18 20048316 missense probably benign 0.16
R7818:Dsc2 UTSW 18 20050132 missense probably damaging 1.00
R7852:Dsc2 UTSW 18 20046285 missense possibly damaging 0.67
R7998:Dsc2 UTSW 18 20034663 missense possibly damaging 0.87
R8029:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8030:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8031:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8032:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8059:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8060:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8061:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8062:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8063:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8082:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8090:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8114:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8115:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8116:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8117:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8118:Dsc2 UTSW 18 20032274 missense possibly damaging 0.78
R8328:Dsc2 UTSW 18 20032519 missense possibly damaging 0.68
R8545:Dsc2 UTSW 18 20034665 nonsense probably null
R9005:Dsc2 UTSW 18 20038094 missense probably benign 0.00
R9017:Dsc2 UTSW 18 20043911 missense probably damaging 1.00
R9111:Dsc2 UTSW 18 20034707 missense probably benign 0.00
Z1088:Dsc2 UTSW 18 20046304 missense probably damaging 0.98
Z1176:Dsc2 UTSW 18 20035299 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACGCTCGGAAAATAGTGATC -3'
(R):5'- AGCTCCATACACTAGAGAGGC -3'

Sequencing Primer
(F):5'- CTCGGAAAATAGTGATCGATCCTG -3'
(R):5'- CTAGAGAGGCTAGCTCAAAGTCAC -3'
Posted On 2022-04-18