Mutagenetix > Incidental Mutation

Incidental Mutation 'R7998:Dsc2'

616229

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

046038-MU

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7998 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 20034663 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 724 (Q724H)

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039247
AA Change: Q724H

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331
AA Change: Q724H

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000075214
AA Change: Q724H

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331
AA Change: Q724H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331
AA Change: Q123H

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	C	T	14: 36,096,692	R216C	probably benign	Het
Acsl3	C	T	1: 78,694,271	P294L	probably damaging	Het
Alox12b	T	C	11: 69,168,837	Y572H	probably damaging	Het
Arid1b	A	G	17: 5,327,684	D1236G	probably damaging	Het
Astl	T	C	2: 127,350,499	L254P	probably damaging	Het
Btbd7	A	C	12: 102,795,240	L562R	probably damaging	Het
Ccdc58	T	A	16: 36,085,033	V65D	probably benign	Het
Chl1	T	C	6: 103,729,289	V1195A	probably benign	Het
Cib1	A	T	7: 80,228,414	Y105*	probably null	Het
Cog3	G	T	14: 75,747,093	S94Y	possibly damaging	Het
Cpne6	A	C	14: 55,516,294	Q403P	probably damaging	Het
Csn1s1	A	G	5: 87,674,228	N119S	possibly damaging	Het
Cux2	T	C	5: 121,868,585	D874G	possibly damaging	Het
Dicer1	A	T	12: 104,704,069	F1079Y	probably damaging	Het
Fam96b	T	A	8: 104,641,036	S94C	probably damaging	Het
Fbxw16	A	G	9: 109,436,698	V351A	probably damaging	Het
G2e3	A	T	12: 51,353,841	E59D	probably benign	Het
Gm10800	A	AC	2: 98,667,033		probably null	Het
Gm10837	G	T	14: 122,490,641		probably benign	Het
Gm14085	T	C	2: 122,494,358	L137P	probably damaging	Het
Gpr137b	T	C	13: 13,359,406	Y355C		Het
Gpr18	T	C	14: 121,911,981	I211V	probably benign	Het
Gstm7	T	A	3: 107,930,341	D98V	probably damaging	Het
Hspa8	A	G	9: 40,804,514	Y525C	probably damaging	Het
Itga7	T	C	10: 128,934,151	S55P	probably damaging	Het
Itpr1	T	C	6: 108,417,948	V1674A	possibly damaging	Het
Itsn1	G	T	16: 91,850,936	G893C	unknown	Het
Kcnc1	A	G	7: 46,397,799	D41G	probably benign	Het
Larp6	A	G	9: 60,724,355	K137E	probably damaging	Het
Leo1	G	T	9: 75,445,276	G34C	probably benign	Het
Map4	G	A	9: 110,079,861	V1050M	probably damaging	Het
Mast3	A	G	8: 70,783,570	V722A	probably benign	Het
Med28	T	A	5: 45,525,199	V69D	probably damaging	Het
Mier1	T	C	4: 103,162,615	F512S	probably benign	Het
Mov10l1	T	A	15: 89,053,439	V1147E	probably damaging	Het
Mroh7	T	C	4: 106,711,281	E409G	probably benign	Het
Muc16	G	T	9: 18,639,892	P5035Q	probably benign	Het
Nemp1	C	A	10: 127,693,489	S213R	probably damaging	Het
Npffr2	T	C	5: 89,583,290	Y360H	probably damaging	Het
Nrxn2	T	C	19: 6,509,875	V1221A	probably damaging	Het
Nup107	A	G	10: 117,757,994	F765L	probably damaging	Het
Nup188	T	C	2: 30,330,971	L991P	probably damaging	Het
Olfr205	T	A	16: 59,329,270	M80L	probably benign	Het
Olfr275	A	T	4: 52,825,970	D191V	possibly damaging	Het
Pla2g7	A	T	17: 43,611,318	I363L	probably benign	Het
Ppp2r1a	T	C	17: 20,961,639	F473S	possibly damaging	Het
Prex1	A	G	2: 166,587,045		probably null	Het
Ptov1	A	G	7: 44,864,929	V263A	probably damaging	Het
Reg3a	T	C	6: 78,381,149	V21A	probably benign	Het
Sdk2	T	A	11: 113,859,938	I550F	probably benign	Het
Shprh	T	A	10: 11,185,341	W1133R	probably damaging	Het
Syne2	T	C	12: 76,087,858	V1297A	probably damaging	Het
Themis2	A	G	4: 132,792,564	I50T	probably damaging	Het
Tmprss15	C	A	16: 79,001,843	L650F	possibly damaging	Het
Ttc41	C	A	10: 86,736,847	N694K	probably benign	Het
Ttll9	T	C	2: 152,991,626	Y215H	possibly damaging	Het
Ttn	C	A	2: 76,903,309	V4541L	unknown	Het
Usp32	G	T	11: 84,994,426	A1265E	probably damaging	Het
Vcan	T	A	13: 89,704,327	D838V	probably damaging	Het
Vmn2r88	T	C	14: 51,414,108	I293T		Het
Wdr36	T	G	18: 32,852,519	D496E	probably damaging	Het
Wrn	T	C	8: 33,292,643	N753S	probably benign	Het
Zmat3	T	C	3: 32,341,666	R231G	possibly damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7179:Dsc2	UTSW	18	20035275	critical splice donor site	probably null
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCCCTGGATGGATGGATG -3'
(R):5'- CTTCTGCTTTGACATTGGCAAAC -3'

Sequencing Primer
(F):5'- TGCTGCTAAGTTATCAGACACCAG -3'
(R):5'- CTGCTTTGACATTGGCAAACATATG -3'

Posted On

2020-01-23