Mutagenetix > Incidental Mutation

Incidental Mutation 'R7179:Dsc2'

558877

Institutional Source

Beutler Lab

Gene Symbol

Dsc2

Ensembl Gene

ENSMUSG00000024331

Gene Name

desmocollin 2

Synonyms

Dsc2b, Dsc2a

MMRRC Submission

Accession Numbers

Genbank: NM_013505; MGI: 103221

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7179 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

20030633-20059554 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 20035275 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000042905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039247] [ENSMUST00000075214] [ENSMUST00000128464]

AlphaFold

P55292

Predicted Effect

probably null
Transcript: ENSMUST00000039247

SMART Domains

Protein: ENSMUSP00000042905
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000075214

SMART Domains

Protein: ENSMUSP00000074702
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Cadherin_pro	31	113	2.82e-37	SMART
CA	156	241	4.66e-11	SMART
CA	265	353	1.87e-24	SMART
low complexity region	358	372	N/A	INTRINSIC
CA	376	470	1.27e-12	SMART
CA	493	575	4.14e-17	SMART
CA	594	676	1.49e-1	SMART
transmembrane domain	696	718	N/A	INTRINSIC
Pfam:Cadherin_C	730	901	3.7e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000128464

SMART Domains

Protein: ENSMUSP00000123010
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
Cadherin_pro	31	113	2.82e-37	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000155407

SMART Domains

Protein: ENSMUSP00000116063
Gene: ENSMUSG00000024331

Domain	Start	End	E-Value	Type
SCOP:d1l3wa5	2	71	2e-3	SMART
Blast:CA	2	76	2e-47	BLAST
transmembrane domain	96	118	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.1%

Validation Efficiency

100% (76/76)

MGI Phenotype

FUNCTION: This gene encodes a member of the desmocollin protein subfamily. Desmocollins are cadherin-like transmembrane glycoproteins that are major components of the desmosome. Desmosomes are cell-cell junctions that help resist shearing forces and are found in high concentrations in cells subject to mechanical stress. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot13	A	T	13: 24,818,171	I96K	probably benign	Het
Adam6a	A	G	12: 113,545,671	T555A	probably benign	Het
Alms1	C	T	6: 85,621,369	P1059L	probably benign	Het
Apol7c	T	C	15: 77,525,643	T368A	probably benign	Het
Arfgef3	A	T	10: 18,599,267	L1557Q	probably damaging	Het
Baz2a	C	T	10: 128,124,457	R1514W	probably damaging	Het
Bmp3	T	A	5: 98,872,763	D348E	probably damaging	Het
Bves	A	G	10: 45,354,817	S295G	probably damaging	Het
Carmil1	A	G	13: 24,020,069	C1328R	probably benign	Het
Ccnk	T	A	12: 108,187,258	Y93N	probably damaging	Het
Ccr1	A	T	9: 123,964,052	V147D	probably damaging	Het
Cd24a	G	A	10: 43,582,640	G36S	probably benign	Het
Cep104	A	G	4: 153,992,867	Y569C	probably damaging	Het
Chd2	A	T	7: 73,475,420	I884N	probably damaging	Het
Cnst	A	T	1: 179,579,382		probably benign	Het
Col22a1	A	G	15: 71,933,413	L146P	unknown	Het
Col25a1	G	T	3: 130,530,119	R321L	probably damaging	Het
Ctnnd2	T	C	15: 30,683,364	Y504H	possibly damaging	Het
D3Ertd751e	C	A	3: 41,748,708	Q73K	probably damaging	Het
Eya1	A	T	1: 14,302,852	S14R	probably damaging	Het
Fam131c	A	T	4: 141,383,017		probably null	Het
Fam71a	G	A	1: 191,164,021	R142C	probably damaging	Het
Flvcr2	T	C	12: 85,747,191	F114L	possibly damaging	Het
Fyn	A	G	10: 39,532,124	D321G	possibly damaging	Het
Galnt5	A	C	2: 57,998,609	M74L	probably benign	Het
Gas2l2	G	A	11: 83,422,462	P675S	probably benign	Het
Gm9508	G	T	10: 77,696,636	Q200K	unknown	Het
Greb1l	G	A	18: 10,544,576	S1390N	probably benign	Het
Hdac5	G	T	11: 102,204,559	T430K	possibly damaging	Het
Hjurp	TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT	TCT	1: 88,266,278		probably benign	Het
Khnyn	C	T	14: 55,894,354	P578S	probably damaging	Het
Lepr	A	T	4: 101,745,659	T215S	probably benign	Het
Lrfn5	G	A	12: 61,843,982	V686I	probably benign	Het
Mapkap1	T	A	2: 34,518,700	H233Q	possibly damaging	Het
Mcm3	A	G	1: 20,814,857	I201T	probably damaging	Het
Metrnl	G	A	11: 121,715,908	R263Q	probably damaging	Het
Mettl22	A	G	16: 8,478,060	E71G	probably benign	Het
Muc16	T	C	9: 18,642,008	T4330A	probably benign	Het
Mug1	A	G	6: 121,857,420	T387A	probably benign	Het
Myh4	A	G	11: 67,244,724	D379G	probably benign	Het
Nbas	A	G	12: 13,405,397	D1204G	possibly damaging	Het
Ncor2	T	C	5: 125,055,783	K478E	unknown	Het
Olfr173	T	A	16: 58,796,887	I320F	probably benign	Het
Olfr294	A	T	7: 86,616,366	L93Q	possibly damaging	Het
Olfr557	A	G	7: 102,698,270	T11A	probably benign	Het
Osbpl7	G	A	11: 97,050,836	V62I	probably benign	Het
Pak1ip1	A	G	13: 41,009,542	N246S	probably damaging	Het
Prim1	A	G	10: 128,015,976	Y39C	probably damaging	Het
Prl3b1	G	T	13: 27,243,844	V46L	probably benign	Het
Prss54	A	T	8: 95,565,571	S127T	probably benign	Het
Rasal3	G	A	17: 32,392,417	T912M	probably damaging	Het
Rrp12	T	A	19: 41,883,778	T420S	probably benign	Het
Rspo1	A	G	4: 125,005,038	N51D	probably damaging	Het
Rufy4	A	G	1: 74,132,876	R253G	probably benign	Het
Scaf1	G	A	7: 45,007,743	R571C	unknown	Het
Scn2a	A	T	2: 65,701,979	H645L	probably damaging	Het
Sec24b	A	G	3: 129,988,946	S1132P	probably damaging	Het
Slc1a2	A	G	2: 102,755,945	K298R	probably damaging	Het
Slc25a54	T	A	3: 109,107,257	N230K	probably benign	Het
Slc27a4	T	G	2: 29,815,652	Y617*	probably null	Het
Slc2a10	T	C	2: 165,515,349	S310P	probably damaging	Het
Snx33	C	T	9: 56,925,867	R306H	probably damaging	Het
Spag9	A	T	11: 94,089,432		probably null	Het
Spg11	A	T	2: 122,101,789		probably null	Het
Sycp2l	A	G	13: 41,129,782	T165A	probably damaging	Het
Syt14	A	G	1: 192,933,263	C189R	probably damaging	Het
Taar9	A	T	10: 24,108,984	L184Q	probably damaging	Het
Tkt	C	T	14: 30,559,858	P111L	probably damaging	Het
Trpc1	A	T	9: 95,721,144	L445Q	possibly damaging	Het
Usp53	A	G	3: 122,949,710	S526P	probably benign	Het
Vps54	T	G	11: 21,298,791	W447G	probably damaging	Het
Xirp2	A	T	2: 67,509,833	H806L	probably benign	Het
Zfp451	A	T	1: 33,802,570	H410Q	unknown	Het
Zfp688	A	G	7: 127,419,312	C214R	probably damaging	Het
Zic4	A	G	9: 91,379,121	D143G	possibly damaging	Het

Other mutations in Dsc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00802:Dsc2	APN	18	20041797	missense	probably benign	0.01
IGL00826:Dsc2	APN	18	20035315	missense	probably damaging	1.00
IGL00852:Dsc2	APN	18	20034683	missense	probably benign	0.01
IGL01082:Dsc2	APN	18	20043792	missense	probably damaging	1.00
IGL01328:Dsc2	APN	18	20048286	missense	probably damaging	0.98
IGL01338:Dsc2	APN	18	20047157	missense	probably benign	0.19
IGL01727:Dsc2	APN	18	20038200	missense	probably benign	0.01
IGL01766:Dsc2	APN	18	20046342	missense	possibly damaging	0.56
IGL02228:Dsc2	APN	18	20043733	missense	probably damaging	0.99
IGL02560:Dsc2	APN	18	20045539	missense	probably damaging	1.00
IGL02794:Dsc2	APN	18	20041731	missense	probably damaging	1.00
3-1:Dsc2	UTSW	18	20047079	missense	possibly damaging	0.60
PIT4305001:Dsc2	UTSW	18	20046243	missense	probably damaging	0.96
PIT4431001:Dsc2	UTSW	18	20046277	nonsense	probably null
R0288:Dsc2	UTSW	18	20033120	missense	probably damaging	1.00
R0542:Dsc2	UTSW	18	20051226	missense	probably damaging	0.99
R0562:Dsc2	UTSW	18	20041537	missense	probably damaging	0.99
R0697:Dsc2	UTSW	18	20041452	missense	probably damaging	0.99
R0940:Dsc2	UTSW	18	20050059	missense	probably damaging	0.97
R1081:Dsc2	UTSW	18	20033295	missense	probably damaging	0.96
R1140:Dsc2	UTSW	18	20032212	missense	probably damaging	1.00
R1515:Dsc2	UTSW	18	20034701	missense	probably damaging	0.99
R1515:Dsc2	UTSW	18	20045565	missense	probably benign	0.40
R1558:Dsc2	UTSW	18	20050151	missense	probably damaging	0.99
R1654:Dsc2	UTSW	18	20046246	missense	probably benign	0.01
R2061:Dsc2	UTSW	18	20032399	missense	possibly damaging	0.79
R2089:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2091:Dsc2	UTSW	18	20033294	missense	possibly damaging	0.65
R2172:Dsc2	UTSW	18	20045502	missense	probably damaging	1.00
R2247:Dsc2	UTSW	18	20035312	missense	probably damaging	1.00
R2472:Dsc2	UTSW	18	20045469	missense	probably benign	0.00
R2927:Dsc2	UTSW	18	20045501	missense	probably damaging	1.00
R3611:Dsc2	UTSW	18	20032351	missense	probably damaging	0.99
R3961:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R3963:Dsc2	UTSW	18	20051227	missense	probably damaging	0.98
R4353:Dsc2	UTSW	18	20050068	missense	probably damaging	1.00
R4362:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R4612:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4613:Dsc2	UTSW	18	20041819	missense	probably damaging	1.00
R4752:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R4946:Dsc2	UTSW	18	20050157	missense	probably damaging	1.00
R5056:Dsc2	UTSW	18	20050142	missense	probably damaging	1.00
R5267:Dsc2	UTSW	18	20034583	critical splice donor site	probably null
R5445:Dsc2	UTSW	18	20035303	missense	possibly damaging	0.76
R5507:Dsc2	UTSW	18	20046279	missense	probably damaging	0.96
R5575:Dsc2	UTSW	18	20035390	missense	probably damaging	1.00
R5781:Dsc2	UTSW	18	20032510	missense	probably benign	0.00
R6102:Dsc2	UTSW	18	20047108	missense	probably benign	0.01
R6129:Dsc2	UTSW	18	20045430	missense	possibly damaging	0.95
R6362:Dsc2	UTSW	18	20035463	nonsense	probably null
R6433:Dsc2	UTSW	18	20051175	critical splice donor site	probably null
R6513:Dsc2	UTSW	18	20046238	missense	probably benign
R6615:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.88
R6619:Dsc2	UTSW	18	20032278	missense	probably benign	0.22
R6665:Dsc2	UTSW	18	20050148	missense	probably damaging	1.00
R6961:Dsc2	UTSW	18	20038222	missense	probably damaging	1.00
R7275:Dsc2	UTSW	18	20051179	nonsense	probably null
R7352:Dsc2	UTSW	18	20035335	missense	probably benign	0.39
R7386:Dsc2	UTSW	18	20041926	missense	possibly damaging	0.84
R7496:Dsc2	UTSW	18	20035394	nonsense	probably null
R7510:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R7580:Dsc2	UTSW	18	20050073	missense	probably damaging	1.00
R7718:Dsc2	UTSW	18	20041778	missense	probably damaging	0.98
R7733:Dsc2	UTSW	18	20048315	missense	probably benign	0.00
R7733:Dsc2	UTSW	18	20048316	missense	probably benign	0.16
R7818:Dsc2	UTSW	18	20050132	missense	probably damaging	1.00
R7852:Dsc2	UTSW	18	20046285	missense	possibly damaging	0.67
R7998:Dsc2	UTSW	18	20034663	missense	possibly damaging	0.87
R8029:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8030:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8031:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8032:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8059:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8060:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8061:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8062:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8063:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8082:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8090:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8114:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8115:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8116:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8117:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8118:Dsc2	UTSW	18	20032274	missense	possibly damaging	0.78
R8328:Dsc2	UTSW	18	20032519	missense	possibly damaging	0.68
R8545:Dsc2	UTSW	18	20034665	nonsense	probably null
R9005:Dsc2	UTSW	18	20038094	missense	probably benign	0.00
R9017:Dsc2	UTSW	18	20043911	missense	probably damaging	1.00
R9111:Dsc2	UTSW	18	20034707	missense	probably benign	0.00
R9396:Dsc2	UTSW	18	20041716	nonsense	probably null
R9487:Dsc2	UTSW	18	20047219	missense	probably damaging	0.99
R9663:Dsc2	UTSW	18	20038148	missense	probably damaging	1.00
Z1088:Dsc2	UTSW	18	20046304	missense	probably damaging	0.98
Z1176:Dsc2	UTSW	18	20035299	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATACTCTGCTGACAAGACAGG -3'
(R):5'- CGAGTTACAGACAGACTTGGTC -3'

Sequencing Primer
(F):5'- GTTCAGTAGATAAATGCGCTCGCC -3'
(R):5'- CTGTCCTCAGTAACCACATTGAATG -3'

Posted On

2019-06-26