Incidental Mutation 'R6999:Umodl1'
ID544424
Institutional Source Beutler Lab
Gene Symbol Umodl1
Ensembl Gene ENSMUSG00000054134
Gene Nameuromodulin-like 1
SynonymsD17Ertd488e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6999 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location30954679-31010708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 30999123 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1228 (A1228V)
Ref Sequence ENSEMBL: ENSMUSP00000110202 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]
Predicted Effect probably damaging
Transcript: ENSMUST00000066554
AA Change: A1228V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: A1228V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000066981
AA Change: A1113V
SMART Domains Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: A1113V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 8.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 8.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 619 632 N/A INTRINSIC
SEA 706 821 8.88e-2 SMART
EGF 818 859 4.26e0 SMART
ZP 909 1152 5.44e-25 SMART
transmembrane domain 1186 1208 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114555
AA Change: A1228V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: A1228V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 34 102 9.7e-13 PFAM
WAP 118 159 3.15e-4 SMART
EGF_like 265 306 3.72e-2 SMART
FN3 305 381 2.61e0 SMART
Pfam:SEA 388 492 9.9e-15 PFAM
EGF 503 545 4.63e-1 SMART
low complexity region 651 661 N/A INTRINSIC
FN3 736 811 6.01e-5 SMART
SEA 821 936 8.88e-2 SMART
EGF 933 974 4.26e0 SMART
ZP 1024 1267 5.44e-25 SMART
transmembrane domain 1301 1323 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G A 1: 71,317,162 Q629* probably null Het
Acss3 C A 10: 107,053,501 G153C probably damaging Het
Alpk2 A G 18: 65,304,513 S1270P probably damaging Het
Ankrd10 A T 8: 11,619,106 L215Q probably damaging Het
Ankrd6 A G 4: 32,823,459 S188P probably benign Het
Brinp2 A G 1: 158,251,305 M316T probably benign Het
Bsn A G 9: 108,113,433 S1707P probably benign Het
C2cd4b C T 9: 67,760,289 A189V probably benign Het
Camk2b C T 11: 5,972,321 R556H probably damaging Het
Cfap126 A G 1: 171,126,164 D101G possibly damaging Het
Chd5 A T 4: 152,374,434 I1085F probably damaging Het
Chp2 A G 7: 122,221,869 E151G probably damaging Het
Chrd A G 16: 20,735,652 T370A probably benign Het
Chrnb2 C T 3: 89,761,315 R231H possibly damaging Het
Crisp4 T A 1: 18,137,035 I10F possibly damaging Het
Csnka2ip T A 16: 64,478,570 H477L unknown Het
Ctu1 T A 7: 43,675,238 F34I probably damaging Het
Dctn1 T A 6: 83,191,281 S407T possibly damaging Het
E330021D16Rik T C 6: 136,401,274 N186S probably benign Het
Ech1 T C 7: 28,830,264 F191L probably benign Het
Enpp3 T C 10: 24,808,166 D60G probably damaging Het
Epha6 T C 16: 60,425,170 Y222C possibly damaging Het
Eppk1 A T 15: 76,109,223 W1153R probably benign Het
Fbxo4 C T 15: 3,977,955 D76N probably damaging Het
Fndc7 G A 3: 108,876,648 A215V probably benign Het
Gemin5 C T 11: 58,125,121 R1352Q probably benign Het
Gm4969 A G 7: 19,102,375 probably benign Het
Gm9639 T C 10: 77,794,691 probably benign Het
Gm973 C A 1: 59,634,092 Q160K unknown Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Grid2 A T 6: 64,076,909 Q364L possibly damaging Het
Kcnn2 T G 18: 45,592,377 S313R probably damaging Het
Kera T C 10: 97,608,952 Y58H probably damaging Het
Mtfr2 T C 10: 20,354,116 L105P probably benign Het
Myom2 A G 8: 15,084,531 T445A probably benign Het
Olfr1394 A G 11: 49,160,412 R133G possibly damaging Het
Olfr905 T A 9: 38,473,239 L164Q probably damaging Het
Pcdha12 T C 18: 37,020,276 L16P probably benign Het
Pcdhb10 T C 18: 37,413,118 Y416H probably damaging Het
Pde8b T C 13: 95,086,834 Y304C possibly damaging Het
Pkd1 T C 17: 24,578,501 I2605T possibly damaging Het
Pnn T C 12: 59,070,299 probably null Het
Ppa1 G A 10: 61,661,017 G95S probably damaging Het
Rapgef4 G T 2: 72,239,125 A730S probably damaging Het
Scap A G 9: 110,384,647 Y1226C probably damaging Het
Scn2a A T 2: 65,682,109 T197S probably benign Het
Slc2a6 GCTTCC GC 2: 27,026,035 probably null Het
Slc8a3 T C 12: 81,314,755 Y430C probably benign Het
Tead3 T C 17: 28,341,532 T33A probably benign Het
Tep1 T A 14: 50,850,705 I792F possibly damaging Het
Trpm2 A T 10: 77,935,891 I638N probably damaging Het
Tuba1c A G 15: 99,037,312 D218G probably benign Het
Tubgcp4 T A 2: 121,192,297 W495R probably damaging Het
Tut1 T C 19: 8,966,018 L823P probably damaging Het
Vmn1r235 T A 17: 21,261,865 F151I probably benign Het
Vmn2r45 T A 7: 8,483,220 K356N probably benign Het
Zfp318 T A 17: 46,400,043 N897K probably damaging Het
Other mutations in Umodl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Umodl1 APN 17 31008750 utr 3 prime probably benign
IGL01344:Umodl1 APN 17 30996264 missense probably damaging 0.99
IGL01529:Umodl1 APN 17 30996259 missense possibly damaging 0.94
IGL01609:Umodl1 APN 17 30998826 missense possibly damaging 0.90
IGL01625:Umodl1 APN 17 30996255 missense probably benign 0.00
IGL01877:Umodl1 APN 17 30982320 missense probably benign 0.00
IGL01977:Umodl1 APN 17 30973768 missense probably damaging 0.99
IGL02063:Umodl1 APN 17 30987914 missense probably benign 0.07
IGL02160:Umodl1 APN 17 30986117 missense probably damaging 0.97
IGL02252:Umodl1 APN 17 30994815 critical splice donor site probably null
IGL02427:Umodl1 APN 17 30968441 splice site probably benign
IGL02496:Umodl1 APN 17 30998654 missense probably damaging 0.99
IGL02633:Umodl1 APN 17 30989488 missense probably damaging 1.00
IGL03271:Umodl1 APN 17 30986499 nonsense probably null
IGL03392:Umodl1 APN 17 30996355 missense probably damaging 0.98
Disquieting UTSW 17 30959155 missense probably damaging 1.00
floored UTSW 17 30988057 nonsense probably null
R7231_umodl1_507 UTSW 17 30986116 missense probably damaging 1.00
surprising UTSW 17 30986465 missense possibly damaging 0.77
unsettling UTSW 17 30986554 nonsense probably null
G1citation:Umodl1 UTSW 17 30986554 nonsense probably null
PIT4468001:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0048:Umodl1 UTSW 17 30968477 missense probably damaging 1.00
R0653:Umodl1 UTSW 17 30984028 missense probably benign 0.00
R0831:Umodl1 UTSW 17 30996351 missense probably damaging 1.00
R1078:Umodl1 UTSW 17 30959373 missense probably benign 0.00
R1166:Umodl1 UTSW 17 31002798 splice site probably benign
R1231:Umodl1 UTSW 17 30959278 missense probably damaging 1.00
R1459:Umodl1 UTSW 17 30982258 splice site probably benign
R1459:Umodl1 UTSW 17 30986504 missense probably benign 0.05
R1510:Umodl1 UTSW 17 30959229 missense probably damaging 1.00
R1654:Umodl1 UTSW 17 30987968 missense probably benign
R1757:Umodl1 UTSW 17 31008700 missense probably damaging 0.99
R1781:Umodl1 UTSW 17 30968550 missense probably damaging 1.00
R1873:Umodl1 UTSW 17 30982264 missense probably damaging 0.99
R1911:Umodl1 UTSW 17 30992154 missense possibly damaging 0.74
R1917:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R1918:Umodl1 UTSW 17 30984043 missense probably damaging 1.00
R2057:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2058:Umodl1 UTSW 17 31008766 critical splice donor site probably null
R2089:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2091:Umodl1 UTSW 17 30971919 missense probably benign 0.00
R2431:Umodl1 UTSW 17 30992088 missense possibly damaging 0.79
R2903:Umodl1 UTSW 17 30992173 missense probably damaging 1.00
R3032:Umodl1 UTSW 17 30989528 missense probably benign 0.01
R3956:Umodl1 UTSW 17 31002863 missense probably benign 0.10
R3975:Umodl1 UTSW 17 30984789 nonsense probably null
R4207:Umodl1 UTSW 17 30959367 missense probably damaging 1.00
R4287:Umodl1 UTSW 17 30988065 missense probably benign 0.11
R4452:Umodl1 UTSW 17 30994815 critical splice donor site probably null
R4684:Umodl1 UTSW 17 30998114 missense probably benign 0.00
R4769:Umodl1 UTSW 17 30984002 missense possibly damaging 0.92
R4887:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R4888:Umodl1 UTSW 17 30999201 missense probably damaging 1.00
R4978:Umodl1 UTSW 17 30986081 missense probably benign
R4993:Umodl1 UTSW 17 30986485 missense probably benign 0.00
R5241:Umodl1 UTSW 17 30984092 missense probably benign 0.18
R5254:Umodl1 UTSW 17 30980359 missense possibly damaging 0.86
R5454:Umodl1 UTSW 17 30986465 missense possibly damaging 0.77
R5456:Umodl1 UTSW 17 30982289 missense probably benign 0.04
R5754:Umodl1 UTSW 17 30994787 missense probably damaging 0.96
R6189:Umodl1 UTSW 17 30996282 missense possibly damaging 0.75
R6222:Umodl1 UTSW 17 31002892 critical splice donor site probably null
R6289:Umodl1 UTSW 17 30982351 missense probably benign 0.16
R6432:Umodl1 UTSW 17 30986147 missense probably benign 0.38
R6478:Umodl1 UTSW 17 30959155 missense probably damaging 1.00
R6702:Umodl1 UTSW 17 30986299 splice site probably null
R6822:Umodl1 UTSW 17 30986554 nonsense probably null
R7067:Umodl1 UTSW 17 30982272 missense probably damaging 1.00
R7123:Umodl1 UTSW 17 30982344 missense possibly damaging 0.90
R7219:Umodl1 UTSW 17 30982262 critical splice acceptor site probably null
R7231:Umodl1 UTSW 17 30986116 missense probably damaging 1.00
R7234:Umodl1 UTSW 17 30986621 missense possibly damaging 0.87
R7297:Umodl1 UTSW 17 31008665 missense probably benign 0.06
R7392:Umodl1 UTSW 17 30982332 missense probably damaging 0.99
R7401:Umodl1 UTSW 17 30998148 missense probably damaging 1.00
R7461:Umodl1 UTSW 17 30988057 nonsense probably null
R7594:Umodl1 UTSW 17 30954805 missense probably benign 0.02
R7613:Umodl1 UTSW 17 30988057 nonsense probably null
R7763:Umodl1 UTSW 17 30986456 missense probably benign 0.24
R7797:Umodl1 UTSW 17 30959151 missense probably benign 0.02
R7832:Umodl1 UTSW 17 30973692 critical splice acceptor site probably null
R7954:Umodl1 UTSW 17 30986387 missense probably benign 0.00
R8088:Umodl1 UTSW 17 30973796 missense probably benign 0.29
R8111:Umodl1 UTSW 17 30971818 missense probably damaging 0.99
R8314:Umodl1 UTSW 17 30984832 missense probably damaging 0.99
R8826:Umodl1 UTSW 17 30983984 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGCCGATTTGAACCCCTTGG -3'
(R):5'- TTGGGGCAACTCCTCTACCAAG -3'

Sequencing Primer
(F):5'- GTATCTCCAGGCAAACTCTGAGTG -3'
(R):5'- GGAAGAAAGCCCTCCCCTG -3'
Posted On2019-05-13