Mutagenetix > Incidental Mutations

Incidental Mutation 'R6999:Umodl1'

544424

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6999 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30954679-31010708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 30999123 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 1228 (A1228V)

Ref Sequence

ENSEMBL: ENSMUSP00000110202 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

Predicted Effect

probably damaging
Transcript: ENSMUST00000066554
AA Change: A1228V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: A1228V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000066981
AA Change: A1113V

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: A1113V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114555
AA Change: A1228V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: A1228V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	G	A	1: 71,317,162	Q629*	probably null	Het
Acss3	C	A	10: 107,053,501	G153C	probably damaging	Het
Alpk2	A	G	18: 65,304,513	S1270P	probably damaging	Het
Ankrd10	A	T	8: 11,619,106	L215Q	probably damaging	Het
Ankrd6	A	G	4: 32,823,459	S188P	probably benign	Het
Brinp2	A	G	1: 158,251,305	M316T	probably benign	Het
Bsn	A	G	9: 108,113,433	S1707P	probably benign	Het
C2cd4b	C	T	9: 67,760,289	A189V	probably benign	Het
Camk2b	C	T	11: 5,972,321	R556H	probably damaging	Het
Cfap126	A	G	1: 171,126,164	D101G	possibly damaging	Het
Chd5	A	T	4: 152,374,434	I1085F	probably damaging	Het
Chp2	A	G	7: 122,221,869	E151G	probably damaging	Het
Chrd	A	G	16: 20,735,652	T370A	probably benign	Het
Chrnb2	C	T	3: 89,761,315	R231H	possibly damaging	Het
Crisp4	T	A	1: 18,137,035	I10F	possibly damaging	Het
Csnka2ip	T	A	16: 64,478,570	H477L	unknown	Het
Ctu1	T	A	7: 43,675,238	F34I	probably damaging	Het
Dctn1	T	A	6: 83,191,281	S407T	possibly damaging	Het
E330021D16Rik	T	C	6: 136,401,274	N186S	probably benign	Het
Ech1	T	C	7: 28,830,264	F191L	probably benign	Het
Enpp3	T	C	10: 24,808,166	D60G	probably damaging	Het
Epha6	T	C	16: 60,425,170	Y222C	possibly damaging	Het
Eppk1	A	T	15: 76,109,223	W1153R	probably benign	Het
Fbxo4	C	T	15: 3,977,955	D76N	probably damaging	Het
Fndc7	G	A	3: 108,876,648	A215V	probably benign	Het
Gemin5	C	T	11: 58,125,121	R1352Q	probably benign	Het
Gm4969	A	G	7: 19,102,375		probably benign	Het
Gm9639	T	C	10: 77,794,691		probably benign	Het
Gm973	C	A	1: 59,634,092	Q160K	unknown	Het
Gpatch2l	G	A	12: 86,244,184	R47H	probably damaging	Het
Grid2	A	T	6: 64,076,909	Q364L	possibly damaging	Het
Kcnn2	T	G	18: 45,592,377	S313R	probably damaging	Het
Kera	T	C	10: 97,608,952	Y58H	probably damaging	Het
Mtfr2	T	C	10: 20,354,116	L105P	probably benign	Het
Myom2	A	G	8: 15,084,531	T445A	probably benign	Het
Olfr1394	A	G	11: 49,160,412	R133G	possibly damaging	Het
Olfr905	T	A	9: 38,473,239	L164Q	probably damaging	Het
Pcdha12	T	C	18: 37,020,276	L16P	probably benign	Het
Pcdhb10	T	C	18: 37,413,118	Y416H	probably damaging	Het
Pde8b	T	C	13: 95,086,834	Y304C	possibly damaging	Het
Pkd1	T	C	17: 24,578,501	I2605T	possibly damaging	Het
Pnn	T	C	12: 59,070,299		probably null	Het
Ppa1	G	A	10: 61,661,017	G95S	probably damaging	Het
Rapgef4	G	T	2: 72,239,125	A730S	probably damaging	Het
Scap	A	G	9: 110,384,647	Y1226C	probably damaging	Het
Scn2a	A	T	2: 65,682,109	T197S	probably benign	Het
Slc2a6	GCTTCC	GC	2: 27,026,035		probably null	Het
Slc8a3	T	C	12: 81,314,755	Y430C	probably benign	Het
Tead3	T	C	17: 28,341,532	T33A	probably benign	Het
Tep1	T	A	14: 50,850,705	I792F	possibly damaging	Het
Trpm2	A	T	10: 77,935,891	I638N	probably damaging	Het
Tuba1c	A	G	15: 99,037,312	D218G	probably benign	Het
Tubgcp4	T	A	2: 121,192,297	W495R	probably damaging	Het
Tut1	T	C	19: 8,966,018	L823P	probably damaging	Het
Vmn1r235	T	A	17: 21,261,865	F151I	probably benign	Het
Vmn2r45	T	A	7: 8,483,220	K356N	probably benign	Het
Zfp318	T	A	17: 46,400,043	N897K	probably damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31008750	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	30996264	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	30996259	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	30998826	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	30996255	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	30982320	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	30973768	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	30987914	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	30986117	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	30994815	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	30968441	splice site	probably benign
IGL02496:Umodl1	APN	17	30998654	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	30989488	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	30986499	nonsense	probably null
IGL03392:Umodl1	APN	17	30996355	missense	probably damaging	0.98
floored	UTSW	17	30988057	nonsense	probably null
surprising	UTSW	17	30986465	missense	possibly damaging	0.77
unsettling	UTSW	17	30986554	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	30968477	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	30984028	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	30996351	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	30959373	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31002798	splice site	probably benign
R1231:Umodl1	UTSW	17	30959278	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	30982258	splice site	probably benign
R1459:Umodl1	UTSW	17	30986504	missense	probably benign	0.05
R1510:Umodl1	UTSW	17	30959229	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	30987968	missense	probably benign
R1757:Umodl1	UTSW	17	31008700	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	30968550	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	30982264	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	30992154	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	30984043	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31008766	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	30971919	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	30992088	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	30992173	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	30989528	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31002863	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	30984789	nonsense	probably null
R4207:Umodl1	UTSW	17	30959367	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	30988065	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	30994815	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	30998114	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	30984002	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	30999201	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	30986081	missense	probably benign
R4993:Umodl1	UTSW	17	30986485	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	30984092	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	30980359	missense	possibly damaging	0.86
R5454:Umodl1	UTSW	17	30986465	missense	possibly damaging	0.77
R5456:Umodl1	UTSW	17	30982289	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	30994787	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	30996282	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31002892	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	30982351	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	30986147	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	30959155	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	30986299	splice site	probably null
R6822:Umodl1	UTSW	17	30986554	nonsense	probably null
R7067:Umodl1	UTSW	17	30982272	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	30982344	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	30982262	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	30986116	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	30986621	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31008665	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	30982332	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	30998148	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	30988057	nonsense	probably null
R7594:Umodl1	UTSW	17	30954805	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	30988057	nonsense	probably null
R7763:Umodl1	UTSW	17	30986456	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	30959151	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	30973692	critical splice acceptor site	probably null
R8088:Umodl1	UTSW	17	30973796	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	30971818	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	30984832	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGCCGATTTGAACCCCTTGG -3'
(R):5'- TTGGGGCAACTCCTCTACCAAG -3'

Sequencing Primer
(F):5'- GTATCTCCAGGCAAACTCTGAGTG -3'
(R):5'- GGAAGAAAGCCCTCCCCTG -3'

Posted On

2019-05-13