Incidental Mutation 'R9451:Plxnd1'
ID 714251
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Name plexin D1
Synonyms b2b553Clo, 6230425C21Rik, b2b1863Clo
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9451 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 115954811-115995005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 115963316 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1369 (E1369G)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
AlphaFold Q3UH93
Predicted Effect possibly damaging
Transcript: ENSMUST00000015511
AA Change: E1369G

PolyPhen 2 Score 0.716 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: E1369G

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1520401A03Rik A G 17: 23,717,213 Y19H unknown Het
Aldh8a1 T A 10: 21,389,133 S220T probably benign Het
Ankrd66 A G 17: 43,534,920 V192A probably benign Het
Atp1a2 A G 1: 172,275,927 Y1009H probably benign Het
BC005561 C A 5: 104,520,778 S1055R probably benign Het
Bptf A C 11: 107,044,585 M142R probably damaging Het
Brwd1 C T 16: 96,044,503 R740Q probably damaging Het
C3 A G 17: 57,224,169 M339T probably benign Het
Catsperg1 A G 7: 29,198,347 probably null Het
Cep295nl T A 11: 118,333,620 K133* probably null Het
Copg2 A T 6: 30,816,851 probably benign Het
Coro7 A T 16: 4,670,538 D89E probably damaging Het
Cyp2t4 G A 7: 27,155,292 V66M possibly damaging Het
Ddx54 G T 5: 120,627,144 R826L probably damaging Het
Dlg4 G T 11: 70,031,239 K162N probably damaging Het
Dna2 T A 10: 62,954,293 L185H probably benign Het
Dock9 C T 14: 121,550,189 probably benign Het
Efcab8 G C 2: 153,804,941 V397L unknown Het
Etl4 A G 2: 20,809,115 I1322V probably benign Het
Exd1 T C 2: 119,524,583 K284E possibly damaging Het
Flnc A G 6: 29,445,463 T786A probably damaging Het
Gm21671 T A 5: 25,951,571 K137* probably null Het
Gm29106 A C 1: 118,199,914 E445D possibly damaging Het
Gm5592 T C 7: 41,286,452 L126P probably damaging Het
Gtf3c2 T G 5: 31,168,429 T389P probably damaging Het
Hhipl1 C A 12: 108,327,841 R669S probably benign Het
Hivep1 A G 13: 42,183,776 T2444A probably benign Het
Hspg2 A G 4: 137,511,069 E289G probably damaging Het
Htatip2 C A 7: 49,759,239 T9K unknown Het
Ifngr1 T C 10: 19,607,293 V265A possibly damaging Het
Ift140 A G 17: 25,033,951 N359D probably benign Het
Mat1a A G 14: 41,114,846 R178G probably damaging Het
Mknk2 C T 10: 80,669,662 R154H probably benign Het
Myh14 C T 7: 44,624,319 probably null Het
Myof A G 19: 37,977,648 probably null Het
Nfe2l1 G T 11: 96,827,627 D27E probably damaging Het
Olfr1234 A T 2: 89,362,899 C177S probably damaging Het
Olfr1301 T C 2: 111,754,873 V208A probably benign Het
Olfr1378 A G 11: 50,969,123 Y35C Het
Olfr284 A G 15: 98,340,263 V242A possibly damaging Het
Olfr485 A G 7: 108,159,261 V204A probably benign Het
Plec C A 15: 76,183,787 Q1139H unknown Het
Plxna2 T A 1: 194,644,384 S209T probably benign Het
Psd3 T C 8: 67,910,835 I3V unknown Het
Pwp1 T A 10: 85,878,564 F195L probably damaging Het
Rab3ip C T 10: 116,939,449 M1I probably null Het
Rad54l2 T C 9: 106,708,289 K759R probably benign Het
Rims2 G T 15: 39,437,328 V344L probably damaging Het
Robo1 G A 16: 73,006,830 R1088Q probably benign Het
Rtf2 A G 2: 172,440,825 probably benign Het
Serhl A C 15: 83,102,966 K131N possibly damaging Het
Sidt1 T A 16: 44,255,029 probably null Het
Slc27a1 T A 8: 71,580,164 Y248* probably null Het
Slitrk3 T A 3: 73,051,283 E52V possibly damaging Het
Snx2 T C 18: 53,210,343 V271A probably benign Het
Snx9 C A 17: 5,899,493 P156Q probably damaging Het
Spag6 C A 2: 18,710,558 Y71* probably null Het
Speg A G 1: 75,417,733 D1724G probably damaging Het
Svs1 A G 6: 48,988,840 Y594C probably damaging Het
Syt7 A G 19: 10,444,168 N572S probably damaging Het
Ticam2 A G 18: 46,560,699 I107T probably damaging Het
Tm7sf3 C T 6: 146,623,681 D89N possibly damaging Het
Tmem268 G A 4: 63,570,019 V135M probably benign Het
Toporsl A G 4: 52,611,663 T519A possibly damaging Het
Trim43b G A 9: 89,091,555 L42F possibly damaging Het
Ttf2 A C 3: 100,944,773 V1019G probably damaging Het
Ugt3a1 A G 15: 9,292,072 D97G probably benign Het
Uncx A G 5: 139,546,720 N180S probably damaging Het
Vmn2r23 A G 6: 123,733,393 T552A probably damaging Het
Vmn2r51 A T 7: 10,099,889 H407Q probably damaging Het
Wdfy4 C T 14: 33,133,561 E699K Het
Wdr95 A G 5: 149,580,700 T324A probably benign Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
Hiss UTSW 6 115969929 missense possibly damaging 0.94
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
rattle UTSW 6 115959794 missense probably damaging 0.96
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4233:Plxnd1 UTSW 6 115965953 missense probably benign 0.30
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
R8539:Plxnd1 UTSW 6 115962807 missense possibly damaging 0.94
R8548:Plxnd1 UTSW 6 115957597 missense probably damaging 1.00
R8963:Plxnd1 UTSW 6 115972545 nonsense probably null
R9119:Plxnd1 UTSW 6 115955871 splice site probably benign
R9177:Plxnd1 UTSW 6 115966508 missense probably benign 0.00
R9182:Plxnd1 UTSW 6 115993785 missense probably damaging 0.98
R9185:Plxnd1 UTSW 6 115957565 missense probably damaging 1.00
R9226:Plxnd1 UTSW 6 115957563 missense probably damaging 1.00
R9433:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R9449:Plxnd1 UTSW 6 115955769 missense probably damaging 1.00
R9599:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9627:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9644:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
R9672:Plxnd1 UTSW 6 115963313 missense possibly damaging 0.78
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AACGGCTGAGTGAATGCCTC -3'
(R):5'- GCTTTTCTCAACCTCAGAACAC -3'

Sequencing Primer
(F):5'- CTGAGTGAATGCCTCCTAGAAG -3'
(R):5'- GAACACAGCAGCTTGCCTG -3'
Posted On 2022-06-15