Mutagenetix > Incidental Mutation

Incidental Mutation 'R4233:Plxnd1'

320958

Institutional Source

Beutler Lab

Gene Symbol

Plxnd1

Ensembl Gene

ENSMUSG00000030123

Gene Name

plexin D1

Synonyms

b2b553Clo, 6230425C21Rik, b2b1863Clo

MMRRC Submission

041642-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4233 (G1)

Quality Score

223

Status

Validated

Chromosome

Chromosomal Location

115954811-115995005 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115965953 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 1257 (N1257D)

Ref Sequence

ENSEMBL: ENSMUSP00000015511 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015511]

AlphaFold

Q3UH93

Predicted Effect

probably benign
Transcript: ENSMUST00000015511
AA Change: N1257D

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: N1257D

Domain	Start	End	E-Value	Type
signal peptide	1	48	N/A	INTRINSIC
Sema	61	531	6.52e-90	SMART
PSI	550	603	6.06e-12	SMART
PSI	703	755	1.06e-2	SMART
Blast:PSI	850	891	9e-20	BLAST
IPT	892	981	4.43e-20	SMART
IPT	982	1068	6.61e-19	SMART
IPT	1070	1149	6.13e-14	SMART
transmembrane domain	1271	1293	N/A	INTRINSIC
Pfam:Plexin_cytopl	1345	1888	5e-238	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131590

SMART Domains

Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

Domain	Start	End	E-Value	Type
Blast:PSI	2	34	1e-13	BLAST
IPT	35	124	4.43e-20	SMART
Blast:IPT	125	177	3e-30	BLAST
Pfam:TIG	180	233	4.6e-6	PFAM

Meta Mutation Damage Score

0.1194

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 96.2%

Validation Efficiency

100% (53/53)

MGI Phenotype

PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123K08Rik	A	T	5: 138,564,192 (GRCm38)	Y96N	probably damaging	Het
Abca15	C	T	7: 120,402,979 (GRCm38)	Q1572*	probably null	Het
Ajuba	T	C	14: 54,569,526 (GRCm38)	R490G	probably damaging	Het
Akap6	T	A	12: 53,139,671 (GRCm38)	N1289K	probably damaging	Het
Ankfy1	G	A	11: 72,714,484 (GRCm38)		probably null	Het
Aph1c	A	G	9: 66,833,321 (GRCm38)	F41S	probably damaging	Het
Arhgap21	A	G	2: 20,887,137 (GRCm38)	V161A	probably damaging	Het
Arhgef18	T	C	8: 3,450,317 (GRCm38)	I541T	possibly damaging	Het
Arhgef40	T	C	14: 51,990,171 (GRCm38)	V458A	possibly damaging	Het
Atg14	T	C	14: 47,551,345 (GRCm38)	K184E	probably benign	Het
Casp8	T	C	1: 58,844,770 (GRCm38)	V432A	probably damaging	Het
Ccar2	T	C	14: 70,151,091 (GRCm38)	T169A	possibly damaging	Het
Cfap58	G	A	19: 47,975,555 (GRCm38)	V541M	possibly damaging	Het
Coro2b	T	C	9: 62,426,185 (GRCm38)	E376G	possibly damaging	Het
Dnah11	T	C	12: 117,916,791 (GRCm38)	T3865A	probably damaging	Het
Dync2h1	T	C	9: 7,134,360 (GRCm38)	E1549G	probably benign	Het
Ercc6l2	T	C	13: 63,872,168 (GRCm38)		probably benign	Het
Fbxo32	G	T	15: 58,192,333 (GRCm38)	T135K	possibly damaging	Het
Fhip2b	A	C	14: 70,586,878 (GRCm38)	V473G	probably damaging	Het
Fras1	A	T	5: 96,714,376 (GRCm38)	I2205F	possibly damaging	Het
Gm12034	A	G	11: 20,446,785 (GRCm38)		noncoding transcript	Het
Gm26678	T	C	3: 54,633,083 (GRCm38)		noncoding transcript	Het
Gm5108	C	A	5: 67,975,153 (GRCm38)	T55K	unknown	Het
Gpa33	A	T	1: 166,146,771 (GRCm38)	D59V	probably damaging	Het
Gpn2	T	A	4: 133,584,705 (GRCm38)	Y83N	probably damaging	Het
Gzf1	C	T	2: 148,686,533 (GRCm38)	P460S	possibly damaging	Het
Ifi203	A	T	1: 173,936,533 (GRCm38)	S124R	possibly damaging	Het
Impg1	A	G	9: 80,345,329 (GRCm38)	L523P	probably damaging	Het
Ldlrap1	T	A	4: 134,757,338 (GRCm38)		probably null	Het
Madd	T	C	2: 91,178,236 (GRCm38)	E107G	probably benign	Het
Med12l	T	G	3: 59,257,223 (GRCm38)		probably null	Het
Nxpe4	A	T	9: 48,398,837 (GRCm38)	T467S	probably damaging	Het
Or52n4	A	G	7: 104,644,988 (GRCm38)	V126A	probably benign	Het
Or7g30	T	A	9: 19,441,590 (GRCm38)	L226I	probably damaging	Het
Pam	A	T	1: 97,864,394 (GRCm38)	V434D	possibly damaging	Het
Prkdc	C	T	16: 15,835,919 (GRCm38)	A3870V	probably benign	Het
Ralgapa1	C	T	12: 55,640,644 (GRCm38)	R2019Q	probably damaging	Het
Rufy4	T	C	1: 74,147,663 (GRCm38)	C537R	probably damaging	Het
Ryr2	T	C	13: 11,750,725 (GRCm38)	D1375G	probably benign	Het
Skint11	C	A	4: 114,244,659 (GRCm38)	Q99K	probably benign	Het
Slc13a2	A	G	11: 78,403,535 (GRCm38)		probably benign	Het
Slc7a13	T	C	4: 19,819,070 (GRCm38)	F90S	probably damaging	Het
Spc24	T	C	9: 21,756,202 (GRCm38)		probably null	Het
Stard13	A	G	5: 151,062,699 (GRCm38)	S331P	probably benign	Het
Sult2a8	T	A	7: 14,413,683 (GRCm38)	I228L	probably benign	Het
Tas2r140	A	T	6: 133,054,952 (GRCm38)	V281D	probably damaging	Het
Tmem38b	T	C	4: 53,840,710 (GRCm38)	C66R	probably damaging	Het
Tshz1	C	A	18: 84,016,195 (GRCm38)	E29D	probably benign	Het
Zfp599	T	A	9: 22,249,745 (GRCm38)	K375*	probably null	Het

Other mutations in Plxnd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00764:Plxnd1	APN	6	115,967,972 (GRCm38)	missense	possibly damaging	0.51
IGL01099:Plxnd1	APN	6	115,969,945 (GRCm38)	missense	probably benign
IGL01323:Plxnd1	APN	6	115,966,799 (GRCm38)	missense	possibly damaging	0.81
IGL01382:Plxnd1	APN	6	115,960,527 (GRCm38)	missense	probably damaging	1.00
IGL01786:Plxnd1	APN	6	115,959,935 (GRCm38)	missense	probably damaging	1.00
IGL02244:Plxnd1	APN	6	115,978,257 (GRCm38)	missense	probably benign	0.39
IGL02272:Plxnd1	APN	6	115,993,628 (GRCm38)	missense	probably damaging	1.00
IGL02293:Plxnd1	APN	6	115,963,913 (GRCm38)	missense	probably damaging	1.00
IGL02465:Plxnd1	APN	6	115,955,742 (GRCm38)	makesense	probably null
IGL02873:Plxnd1	APN	6	115,959,976 (GRCm38)	missense	probably damaging	1.00
IGL03209:Plxnd1	APN	6	115,962,357 (GRCm38)	missense	probably damaging	1.00
Hiss	UTSW	6	115,969,929 (GRCm38)	missense	possibly damaging	0.94
murmer	UTSW	6	115,968,793 (GRCm38)	missense	probably benign	0.00
mutter	UTSW	6	115,968,044 (GRCm38)	missense	probably benign	0.27
rattle	UTSW	6	115,959,794 (GRCm38)	missense	probably damaging	0.96
R0238:Plxnd1	UTSW	6	115,968,793 (GRCm38)	missense	probably benign	0.00
R0238:Plxnd1	UTSW	6	115,968,793 (GRCm38)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,968,793 (GRCm38)	missense	probably benign	0.00
R0239:Plxnd1	UTSW	6	115,968,793 (GRCm38)	missense	probably benign	0.00
R0357:Plxnd1	UTSW	6	115,969,460 (GRCm38)	missense	probably benign	0.00
R0646:Plxnd1	UTSW	6	115,958,699 (GRCm38)	splice site	probably benign
R0648:Plxnd1	UTSW	6	115,994,001 (GRCm38)	missense	possibly damaging	0.86
R0718:Plxnd1	UTSW	6	115,966,638 (GRCm38)	missense	possibly damaging	0.68
R1116:Plxnd1	UTSW	6	115,967,005 (GRCm38)	splice site	probably null
R1292:Plxnd1	UTSW	6	115,962,683 (GRCm38)	unclassified	probably benign
R1715:Plxnd1	UTSW	6	115,968,681 (GRCm38)	missense	probably benign	0.02
R1760:Plxnd1	UTSW	6	115,967,779 (GRCm38)	missense	possibly damaging	0.95
R1799:Plxnd1	UTSW	6	115,994,057 (GRCm38)	missense	probably damaging	1.00
R1817:Plxnd1	UTSW	6	115,980,601 (GRCm38)	missense	possibly damaging	0.83
R1848:Plxnd1	UTSW	6	115,966,546 (GRCm38)	missense	probably damaging	1.00
R1851:Plxnd1	UTSW	6	115,963,914 (GRCm38)	missense	probably damaging	1.00
R1864:Plxnd1	UTSW	6	115,969,441 (GRCm38)	splice site	probably null
R1865:Plxnd1	UTSW	6	115,969,441 (GRCm38)	splice site	probably null
R1875:Plxnd1	UTSW	6	115,978,084 (GRCm38)	splice site	probably null
R1899:Plxnd1	UTSW	6	115,969,363 (GRCm38)	missense	probably benign
R1913:Plxnd1	UTSW	6	115,978,017 (GRCm38)	missense	possibly damaging	0.50
R1970:Plxnd1	UTSW	6	115,962,517 (GRCm38)	missense	probably damaging	1.00
R2007:Plxnd1	UTSW	6	115,967,255 (GRCm38)	missense	probably damaging	1.00
R2134:Plxnd1	UTSW	6	115,957,548 (GRCm38)	missense	probably damaging	1.00
R2202:Plxnd1	UTSW	6	115,962,764 (GRCm38)	missense	probably benign	0.45
R2230:Plxnd1	UTSW	6	115,964,144 (GRCm38)	missense	probably damaging	1.00
R2267:Plxnd1	UTSW	6	115,962,743 (GRCm38)	missense	probably benign	0.29
R2427:Plxnd1	UTSW	6	115,967,748 (GRCm38)	critical splice donor site	probably null
R4108:Plxnd1	UTSW	6	115,959,315 (GRCm38)	missense	probably damaging	1.00
R4280:Plxnd1	UTSW	6	115,956,095 (GRCm38)	splice site	probably null
R4280:Plxnd1	UTSW	6	115,956,094 (GRCm38)	splice site	probably benign
R4346:Plxnd1	UTSW	6	115,977,980 (GRCm38)	missense	probably benign	0.16
R4439:Plxnd1	UTSW	6	115,993,976 (GRCm38)	missense	probably damaging	0.99
R4572:Plxnd1	UTSW	6	115,955,756 (GRCm38)	missense	probably damaging	1.00
R4576:Plxnd1	UTSW	6	115,968,044 (GRCm38)	missense	probably benign	0.27
R4599:Plxnd1	UTSW	6	115,994,276 (GRCm38)	missense	probably damaging	1.00
R4614:Plxnd1	UTSW	6	115,972,525 (GRCm38)	missense	possibly damaging	0.83
R4700:Plxnd1	UTSW	6	115,958,615 (GRCm38)	missense	probably damaging	1.00
R4705:Plxnd1	UTSW	6	115,958,620 (GRCm38)	missense	probably damaging	1.00
R4806:Plxnd1	UTSW	6	115,960,855 (GRCm38)	missense	probably damaging	1.00
R4944:Plxnd1	UTSW	6	115,955,765 (GRCm38)	missense	probably damaging	1.00
R4977:Plxnd1	UTSW	6	115,994,376 (GRCm38)	missense	probably damaging	1.00
R5069:Plxnd1	UTSW	6	115,965,901 (GRCm38)	missense	probably damaging	0.98
R5155:Plxnd1	UTSW	6	115,958,988 (GRCm38)	critical splice donor site	probably null
R5460:Plxnd1	UTSW	6	115,957,648 (GRCm38)	missense	probably damaging	1.00
R5729:Plxnd1	UTSW	6	115,965,877 (GRCm38)	missense	probably damaging	1.00
R5909:Plxnd1	UTSW	6	115,968,688 (GRCm38)	missense	probably benign	0.00
R5992:Plxnd1	UTSW	6	115,967,787 (GRCm38)	critical splice acceptor site	probably null
R6129:Plxnd1	UTSW	6	115,978,174 (GRCm38)	missense	probably damaging	1.00
R6254:Plxnd1	UTSW	6	115,977,960 (GRCm38)	missense	probably benign	0.01
R6273:Plxnd1	UTSW	6	115,978,492 (GRCm38)	missense	probably damaging	1.00
R6310:Plxnd1	UTSW	6	115,976,736 (GRCm38)	missense	possibly damaging	0.94
R6732:Plxnd1	UTSW	6	115,969,929 (GRCm38)	missense	possibly damaging	0.94
R6857:Plxnd1	UTSW	6	115,993,763 (GRCm38)	missense	probably benign	0.05
R7243:Plxnd1	UTSW	6	115,972,507 (GRCm38)	missense	probably benign	0.00
R7282:Plxnd1	UTSW	6	115,960,837 (GRCm38)	missense	probably damaging	1.00
R7632:Plxnd1	UTSW	6	115,976,639 (GRCm38)	missense	probably benign
R7699:Plxnd1	UTSW	6	115,959,794 (GRCm38)	missense	probably damaging	0.96
R7915:Plxnd1	UTSW	6	115,966,918 (GRCm38)	missense	probably benign	0.00
R8090:Plxnd1	UTSW	6	115,956,617 (GRCm38)	missense	probably damaging	1.00
R8382:Plxnd1	UTSW	6	115,972,472 (GRCm38)	missense	probably benign
R8507:Plxnd1	UTSW	6	115,966,905 (GRCm38)	missense	probably damaging	0.97
R8539:Plxnd1	UTSW	6	115,962,807 (GRCm38)	missense	possibly damaging	0.94
R8548:Plxnd1	UTSW	6	115,957,597 (GRCm38)	missense	probably damaging	1.00
R8963:Plxnd1	UTSW	6	115,972,545 (GRCm38)	nonsense	probably null
R9119:Plxnd1	UTSW	6	115,955,871 (GRCm38)	splice site	probably benign
R9177:Plxnd1	UTSW	6	115,966,508 (GRCm38)	missense	probably benign	0.00
R9182:Plxnd1	UTSW	6	115,993,785 (GRCm38)	missense	probably damaging	0.98
R9185:Plxnd1	UTSW	6	115,957,565 (GRCm38)	missense	probably damaging	1.00
R9226:Plxnd1	UTSW	6	115,957,563 (GRCm38)	missense	probably damaging	1.00
R9433:Plxnd1	UTSW	6	115,968,793 (GRCm38)	missense	probably benign	0.00
R9449:Plxnd1	UTSW	6	115,955,769 (GRCm38)	missense	probably damaging	1.00
R9451:Plxnd1	UTSW	6	115,963,316 (GRCm38)	missense	possibly damaging	0.72
R9599:Plxnd1	UTSW	6	115,963,313 (GRCm38)	missense	possibly damaging	0.78
R9627:Plxnd1	UTSW	6	115,963,313 (GRCm38)	missense	possibly damaging	0.78
R9644:Plxnd1	UTSW	6	115,963,313 (GRCm38)	missense	possibly damaging	0.78
R9672:Plxnd1	UTSW	6	115,963,313 (GRCm38)	missense	possibly damaging	0.78
X0024:Plxnd1	UTSW	6	115,963,310 (GRCm38)	missense	probably benign	0.02
X0026:Plxnd1	UTSW	6	115,966,784 (GRCm38)	missense	possibly damaging	0.88
Z1088:Plxnd1	UTSW	6	115,967,510 (GRCm38)	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGATCCTACCAATATCTGCCAC -3'
(R):5'- TTGGCCTCTGCACCAAACTC -3'

Sequencing Primer
(F):5'- GTGCCTAACCATGTCCACC -3'
(R):5'- TTGTCTGTGAGGCTCAGA -3'

Posted On

2015-06-12