Incidental Mutation 'R7146:Vmn2r111'
ID 553839
Institutional Source Beutler Lab
Gene Symbol Vmn2r111
Ensembl Gene ENSMUSG00000095093
Gene Name vomeronasal 2, receptor 111
Synonyms EG210876
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R7146 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 22547941-22573273 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 22559051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 549 (N549S)
Ref Sequence ENSEMBL: ENSMUSP00000090148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092491]
AlphaFold K7N674
Predicted Effect possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.5e-29 PFAM
Pfam:NCD3G 512 565 1.1e-20 PFAM
Pfam:7tm_3 595 833 5.6e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 95% (99/104)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A T 7: 120,255,297 I895F probably benign Het
Abca16 A G 7: 120,527,751 N1222D possibly damaging Het
Abcc4 A T 14: 118,615,181 Y499N probably damaging Het
Adgrg7 A C 16: 56,730,242 C702W probably damaging Het
Adk C A 14: 21,326,614 P27H Het
Ankrd13a T C 5: 114,775,232 S2P probably damaging Het
Ano1 T C 7: 144,655,656 H269R probably benign Het
Aox3 T A 1: 58,158,529 probably null Het
Asl G A 5: 130,024,449 probably benign Het
Asxl2 A T 12: 3,457,066 D86V probably damaging Het
Ate1 A T 7: 130,481,778 probably null Het
Bach2 A G 4: 32,562,670 D379G probably damaging Het
Bdkrb1 T A 12: 105,604,883 L236Q probably damaging Het
Cacna2d3 T C 14: 29,721,697 Y24C unknown Het
Cage1 G T 13: 38,023,049 N273K probably benign Het
Ccdc51 T A 9: 109,091,780 I245N probably damaging Het
Cep152 T C 2: 125,614,405 I229V probably benign Het
Chst4 T A 8: 110,030,731 S167C probably damaging Het
Cntnap4 A T 8: 112,810,636 Y713F probably damaging Het
Cntnap5b G A 1: 100,050,794 probably null Het
Cog8 G T 8: 107,052,373 T424K possibly damaging Het
Cop1 T G 1: 159,244,352 probably null Het
Cyp2j6 A G 4: 96,545,782 I97T probably damaging Het
D430041D05Rik T C 2: 104,258,353 T131A probably benign Het
Dnah17 T C 11: 118,082,110 D1999G probably damaging Het
Dnah8 A G 17: 30,644,617 D250G probably benign Het
Dnah8 T C 17: 30,769,644 V3196A possibly damaging Het
Dscam A T 16: 96,829,917 Y299* probably null Het
Ephb1 A G 9: 101,963,958 S774P probably damaging Het
Fat1 G A 8: 44,950,925 V238I probably benign Het
Fermt1 C T 2: 132,934,865 M234I probably benign Het
Fmnl2 C T 2: 53,068,540 S212L Het
Frem1 T C 4: 82,922,295 N1798S possibly damaging Het
Gabrd T A 4: 155,385,406 M449L probably benign Het
Gad1 T C 2: 70,587,362 F302L probably benign Het
Gm10800 A AC 2: 98,667,033 probably null Het
Gm11639 A G 11: 104,967,752 N3879S unknown Het
Gm11639 A C 11: 105,022,938 D4594A probably benign Het
Gm21886 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA 18: 80,089,482 probably benign Het
Gnb3 C T 6: 124,836,924 probably null Het
Gtf3c1 A T 7: 125,672,821 M642K possibly damaging Het
Hps3 A T 3: 20,008,886 W838R probably damaging Het
Ide A T 19: 37,295,944 W527R Het
Ighe A T 12: 113,272,355 I117N Het
Ighv1-50 T C 12: 115,119,776 E108G probably benign Het
Ivl G A 3: 92,572,231 P176S probably damaging Het
Lamb2 T A 9: 108,484,084 L605Q possibly damaging Het
Lgi3 G A 14: 70,533,392 R157H probably damaging Het
Lrp1b G T 2: 41,375,994 C1053* probably null Het
Mcpt9 A T 14: 56,026,988 S217T probably damaging Het
Mgat4c T G 10: 102,388,496 N190K probably damaging Het
Mknk1 T A 4: 115,864,592 V111D probably damaging Het
Mmp11 T C 10: 75,928,446 T62A probably benign Het
Mmp1b C A 9: 7,385,014 V212F probably damaging Het
Mmp7 A G 9: 7,697,586 probably null Het
Muc5b C T 7: 141,863,967 T3550M possibly damaging Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nphp3 A T 9: 104,004,837 K169* probably null Het
Npy6r G T 18: 44,275,721 V70F probably benign Het
Nsun2 T A 13: 69,626,553 probably null Het
Oplah T A 15: 76,302,660 I652F probably benign Het
Pcdh18 T C 3: 49,755,822 N348S probably damaging Het
Pcdhb5 T A 18: 37,321,356 V263D probably damaging Het
Pcdhga1 C A 18: 37,662,111 T56N probably benign Het
Pdk4 A G 6: 5,491,068 probably null Het
Pfkp C A 13: 6,602,781 V434F probably benign Het
Phospho1 G A 11: 95,830,906 R134H probably damaging Het
Polg2 G T 11: 106,772,746 Q374K probably benign Het
Ptpra T C 2: 130,537,651 probably null Het
Rassf3 C T 10: 121,416,147 E120K probably benign Het
Reln A T 5: 22,106,097 S273T probably damaging Het
Scarb1 C T 5: 125,284,025 A133T probably benign Het
Scn3a T A 2: 65,483,142 K1142N probably damaging Het
Sema3c G A 5: 17,694,703 V398I probably benign Het
Serpine1 C A 5: 137,071,064 Q80H probably damaging Het
Sh3gl1 G A 17: 56,017,646 T334M probably damaging Het
Smg7 T C 1: 152,861,825 N122D probably benign Het
Speer4b T C 5: 27,498,710 I144V probably benign Het
Spire2 T A 8: 123,369,250 D671E probably benign Het
Sspo A T 6: 48,501,095 H5144L probably benign Het
Sstr2 A T 11: 113,625,353 Q366L probably damaging Het
Ssu72 T C 4: 155,731,393 F98S probably damaging Het
Syde2 C T 3: 146,007,115 Q1003* probably null Het
Tapbp G A 17: 33,925,487 A186T possibly damaging Het
Tcf12 T A 9: 71,883,103 probably null Het
Tnfrsf22 A T 7: 143,640,819 C124S probably damaging Het
Txlnb A T 10: 17,827,798 T235S possibly damaging Het
Uaca T C 9: 60,870,413 L694P probably damaging Het
Unc13a T A 8: 71,630,553 N1620Y probably damaging Het
Vmn2r10 C T 5: 109,003,334 C138Y probably damaging Het
Vmn2r28 T A 7: 5,481,496 E568D probably benign Het
Vmn2r57 A T 7: 41,448,471 H57Q possibly damaging Het
Vwa5b1 A G 4: 138,581,612 S756P probably benign Het
Washc5 C A 15: 59,352,501 E470* probably null Het
Xpot A T 10: 121,606,773 V508D probably damaging Het
Zfp616 A T 11: 74,085,261 K785N possibly damaging Het
Zfp653 T C 9: 22,065,899 N119D probably damaging Het
Zfp729b A G 13: 67,593,376 S257P probably damaging Het
Zfp82 T A 7: 30,056,167 T497S probably benign Het
Znrf4 T G 17: 56,512,305 M1L probably benign Het
Other mutations in Vmn2r111
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Vmn2r111 APN 17 22548753 missense probably benign 0.00
IGL01306:Vmn2r111 APN 17 22568984 missense probably damaging 0.99
IGL01309:Vmn2r111 APN 17 22569016 missense possibly damaging 0.51
IGL01457:Vmn2r111 APN 17 22571985 nonsense probably null
IGL01465:Vmn2r111 APN 17 22548737 missense probably benign 0.00
IGL01505:Vmn2r111 APN 17 22548572 missense probably benign 0.00
IGL01571:Vmn2r111 APN 17 22571392 missense probably damaging 0.99
IGL01715:Vmn2r111 APN 17 22569073 splice site probably benign
IGL01962:Vmn2r111 APN 17 22548284 missense possibly damaging 0.90
IGL02190:Vmn2r111 APN 17 22570773 missense probably benign 0.00
IGL02496:Vmn2r111 APN 17 22568856 missense probably benign
IGL02519:Vmn2r111 APN 17 22548339 missense possibly damaging 0.80
IGL02616:Vmn2r111 APN 17 22571050 missense possibly damaging 0.67
IGL02641:Vmn2r111 APN 17 22573224 missense possibly damaging 0.82
IGL02690:Vmn2r111 APN 17 22559042 critical splice donor site probably null
IGL02698:Vmn2r111 APN 17 22571245 missense probably damaging 1.00
IGL03017:Vmn2r111 APN 17 22570858 missense probably damaging 1.00
R0046:Vmn2r111 UTSW 17 22548009 missense probably benign
R0064:Vmn2r111 UTSW 17 22572072 missense probably benign 0.00
R0519:Vmn2r111 UTSW 17 22573121 missense probably benign 0.02
R1439:Vmn2r111 UTSW 17 22571116 missense probably benign 0.00
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1467:Vmn2r111 UTSW 17 22571047 missense probably damaging 0.99
R1636:Vmn2r111 UTSW 17 22571399 missense probably damaging 1.00
R1647:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1648:Vmn2r111 UTSW 17 22569061 missense probably benign 0.03
R1697:Vmn2r111 UTSW 17 22548060 missense probably benign 0.26
R1996:Vmn2r111 UTSW 17 22548081 missense probably benign 0.21
R2040:Vmn2r111 UTSW 17 22548414 missense probably damaging 1.00
R2075:Vmn2r111 UTSW 17 22559062 missense probably damaging 1.00
R2134:Vmn2r111 UTSW 17 22573104 missense possibly damaging 0.68
R2357:Vmn2r111 UTSW 17 22559170 splice site probably benign
R3700:Vmn2r111 UTSW 17 22571161 nonsense probably null
R3782:Vmn2r111 UTSW 17 22571320 missense possibly damaging 0.89
R4085:Vmn2r111 UTSW 17 22559115 missense probably benign 0.00
R4323:Vmn2r111 UTSW 17 22573178 missense probably benign 0.02
R4900:Vmn2r111 UTSW 17 22548656 missense possibly damaging 0.94
R5072:Vmn2r111 UTSW 17 22548041 missense probably damaging 0.99
R5123:Vmn2r111 UTSW 17 22571143 missense possibly damaging 0.82
R5181:Vmn2r111 UTSW 17 22571020 missense possibly damaging 0.56
R5357:Vmn2r111 UTSW 17 22548102 nonsense probably null
R5398:Vmn2r111 UTSW 17 22573271 start codon destroyed probably null 0.88
R5434:Vmn2r111 UTSW 17 22548489 missense probably damaging 0.99
R5462:Vmn2r111 UTSW 17 22548257 missense probably damaging 1.00
R6149:Vmn2r111 UTSW 17 22548815 missense probably benign 0.00
R6149:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6207:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6281:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6282:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6283:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6307:Vmn2r111 UTSW 17 22573089 missense probably benign 0.00
R6323:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6325:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6367:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6368:Vmn2r111 UTSW 17 22571908 missense probably benign 0.38
R6369:Vmn2r111 UTSW 17 22548602 missense probably damaging 1.00
R6489:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6490:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6546:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6547:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6557:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6654:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6655:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6657:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6659:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6660:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6664:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6798:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6799:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6801:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6893:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6895:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6897:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6922:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6923:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6944:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R6945:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7017:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7018:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7024:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7031:Vmn2r111 UTSW 17 22571245 missense probably damaging 1.00
R7039:Vmn2r111 UTSW 17 22548184 missense probably damaging 1.00
R7053:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7054:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7055:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7056:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7145:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7246:Vmn2r111 UTSW 17 22548714 missense probably damaging 1.00
R7259:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7260:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7327:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7401:Vmn2r111 UTSW 17 22571086 missense possibly damaging 0.93
R7514:Vmn2r111 UTSW 17 22548399 missense probably benign 0.05
R7651:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7781:Vmn2r111 UTSW 17 22570733 missense probably benign 0.17
R7816:Vmn2r111 UTSW 17 22573102 missense probably damaging 0.97
R7821:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R7838:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8078:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8080:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8117:Vmn2r111 UTSW 17 22571488 missense probably benign 0.12
R8171:Vmn2r111 UTSW 17 22573092 missense probably benign 0.10
R8195:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8197:Vmn2r111 UTSW 17 22559051 missense possibly damaging 0.50
R8411:Vmn2r111 UTSW 17 22548581 missense probably benign 0.03
R8539:Vmn2r111 UTSW 17 22571293 missense probably benign 0.23
R8540:Vmn2r111 UTSW 17 22559042 critical splice donor site probably null
R8540:Vmn2r111 UTSW 17 22559043 missense probably damaging 1.00
R8557:Vmn2r111 UTSW 17 22571929 nonsense probably null
R8720:Vmn2r111 UTSW 17 22573213 missense possibly damaging 0.88
R8729:Vmn2r111 UTSW 17 22548258 missense probably damaging 1.00
R8843:Vmn2r111 UTSW 17 22548030 missense probably benign 0.00
R9184:Vmn2r111 UTSW 17 22571841 missense probably benign
R9374:Vmn2r111 UTSW 17 22568878 missense probably benign 0.17
R9452:Vmn2r111 UTSW 17 22559151 missense probably damaging 1.00
X0026:Vmn2r111 UTSW 17 22548695 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGATGCAGCCCAATTTCTAC -3'
(R):5'- GGAGTTGGGAAACAATTCAACTTATCC -3'

Sequencing Primer
(F):5'- TGAGTAACTTAGGACAGAGAT -3'
(R):5'- ACAATGCACTAAATAAGGTCTGC -3'
Posted On 2019-05-15