Incidental Mutation 'R8324:Rictor'
ID 644013
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene Name RPTOR independent companion of MTOR, complex 2
Synonyms D530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8324 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 6708379-6800401 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 6745562 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 125 (V125E)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
AlphaFold Q6QI06
Predicted Effect probably damaging
Transcript: ENSMUST00000061656
AA Change: V125E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: V125E

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,290,395 S753P probably damaging Het
Acan A G 7: 79,091,056 E390G probably damaging Het
Antxr2 T C 5: 97,938,509 N413S probably damaging Het
Bace2 C T 16: 97,356,908 A36V possibly damaging Het
Caprin1 G A 2: 103,783,181 R79* probably null Het
Cdan1 A G 2: 120,727,325 V507A probably benign Het
Cdkl3 T A 11: 52,022,879 probably null Het
Chst5 A T 8: 111,890,508 L160Q probably benign Het
Col11a1 C G 3: 114,164,410 P1111R probably damaging Het
Col6a6 T A 9: 105,755,654 E1470D probably benign Het
Cpped1 T A 16: 11,805,476 T274S probably benign Het
Ctnnbl1 G A 2: 157,779,815 E75K probably damaging Het
Cyp4f40 T C 17: 32,659,528 S15P probably benign Het
Ddx46 T C 13: 55,663,914 S643P probably damaging Het
Defb34 A G 8: 19,123,798 Q16R probably null Het
Dhrs2 T A 14: 55,238,764 V147E probably damaging Het
Dnah5 G T 15: 28,346,865 R2498L probably damaging Het
Dpp10 T A 1: 123,854,172 I93F probably benign Het
Eef1e1 T A 13: 38,655,069 D104V probably damaging Het
Egfr A G 11: 16,858,971 Y55C probably damaging Het
Egfr A C 11: 16,908,885 I955L probably damaging Het
Ehbp1l1 C A 19: 5,719,998 V426F possibly damaging Het
Fam234a C T 17: 26,218,698 V108I probably benign Het
Fzd8 T A 18: 9,214,688 M590K probably damaging Het
Gm13287 T C 4: 88,803,638 S129P probably damaging Het
Heatr5b A G 17: 78,755,364 S1919P possibly damaging Het
Hspg2 C G 4: 137,518,979 P1023A possibly damaging Het
Ikbkap C T 4: 56,772,491 E877K probably damaging Het
Itpr2 T C 6: 146,328,398 E1233G probably damaging Het
Kcnmb4 A G 10: 116,418,314 L186P probably damaging Het
Krt72 T A 15: 101,782,145 Y224F probably damaging Het
Loxhd1 T C 18: 77,339,579 probably null Het
Lrguk A G 6: 34,102,571 T914A probably benign Het
Lrrtm4 A G 6: 80,021,991 T129A probably damaging Het
Mmp13 A T 9: 7,276,636 I244F possibly damaging Het
Mob1a T A 6: 83,329,974 L41Q probably damaging Het
Mtcl1 T C 17: 66,436,217 R426G probably damaging Het
Mybbp1a T C 11: 72,445,288 probably null Het
Myh9 A G 15: 77,788,917 probably null Het
Myo1d T A 11: 80,557,521 D926V probably damaging Het
Ncapg T G 5: 45,695,668 H825Q probably damaging Het
Olfml1 T C 7: 107,590,363 S212P probably benign Het
Olfr656 G A 7: 104,618,114 R145H probably benign Het
Pak2 T C 16: 32,052,211 N51S probably benign Het
Papln T C 12: 83,786,619 Y1132H probably damaging Het
Pax3 T A 1: 78,193,789 R134S probably damaging Het
Pdzrn4 A G 15: 92,770,937 E990G probably damaging Het
Peak1 A T 9: 56,207,476 W1394R probably damaging Het
Pkn2 T C 3: 142,829,010 N285D probably benign Het
Pramef12 A C 4: 144,395,857 L39R probably damaging Het
Prrc2a A G 17: 35,156,984 S897P possibly damaging Het
Rad51 A G 2: 119,123,831 T131A possibly damaging Het
Rc3h2 T A 2: 37,400,726 T255S possibly damaging Het
Repin1 G T 6: 48,597,345 E403* probably null Het
Rps6ka5 C T 12: 100,558,487 D664N possibly damaging Het
Rreb1 T A 13: 37,947,621 W1584R probably damaging Het
Rxra T C 2: 27,741,183 I142T probably damaging Het
Sall2 T C 14: 52,312,886 T951A probably benign Het
Slc15a2 T G 16: 36,759,307 N359T probably damaging Het
Slc23a1 C T 18: 35,622,535 G436E probably damaging Het
Slc6a13 T C 6: 121,337,414 *603Q probably null Het
Sptb T C 12: 76,619,162 D894G possibly damaging Het
Srgn A G 10: 62,507,665 L17P probably damaging Het
Tmprss9 T C 10: 80,897,371 probably null Het
Trav9n-4 T C 14: 53,294,946 F86L probably benign Het
Trp63 A G 16: 25,876,734 Y482C unknown Het
Ttc9b G T 7: 27,653,969 A15S probably damaging Het
Urb1 A T 16: 90,791,190 I410N probably damaging Het
Vmn2r82 A T 10: 79,378,893 K237* probably null Het
Wwox G A 8: 114,489,005 probably null Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
Tense UTSW 15 6759496 missense possibly damaging 0.94
Tonus UTSW 15 6769334 critical splice donor site probably null
Torrid UTSW 15 6759572 missense probably damaging 1.00
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1655:Rictor UTSW 15 6772212 missense probably benign 0.00
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
R7749:Rictor UTSW 15 6772154 missense probably benign 0.27
R7750:Rictor UTSW 15 6772154 missense probably benign 0.27
R7751:Rictor UTSW 15 6772154 missense probably benign 0.27
R7753:Rictor UTSW 15 6772154 missense probably benign 0.27
R7841:Rictor UTSW 15 6772154 missense probably benign 0.27
R7894:Rictor UTSW 15 6772154 missense probably benign 0.27
R7897:Rictor UTSW 15 6772154 missense probably benign 0.27
R7898:Rictor UTSW 15 6772154 missense probably benign 0.27
R7937:Rictor UTSW 15 6772154 missense probably benign 0.27
R7944:Rictor UTSW 15 6772154 missense probably benign 0.27
R8062:Rictor UTSW 15 6772154 missense probably benign 0.27
R8063:Rictor UTSW 15 6772154 missense probably benign 0.27
R8094:Rictor UTSW 15 6772154 missense probably benign 0.27
R8119:Rictor UTSW 15 6772154 missense probably benign 0.27
R8134:Rictor UTSW 15 6772154 missense probably benign 0.27
R8166:Rictor UTSW 15 6769334 critical splice donor site probably null
R8343:Rictor UTSW 15 6778319 critical splice donor site probably null
R8691:Rictor UTSW 15 6787032 missense probably damaging 1.00
R8859:Rictor UTSW 15 6783586 missense probably damaging 0.98
R8953:Rictor UTSW 15 6794447 missense probably benign 0.39
R8977:Rictor UTSW 15 6783085 missense probably benign
R9008:Rictor UTSW 15 6772129 splice site probably benign
R9369:Rictor UTSW 15 6744367 missense probably benign 0.00
R9563:Rictor UTSW 15 6768081 missense possibly damaging 0.83
R9695:Rictor UTSW 15 6786529 missense probably benign 0.00
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCCCAAGCATTTCACATGGG -3'
(R):5'- TGCTTGAAAGTATAAAGGGAGTCC -3'

Sequencing Primer
(F):5'- CAAAGTAACCTCTGCTGAACTGTGG -3'
(R):5'- GGAGTCCCTCCTTTGCTAAAAAC -3'
Posted On 2020-09-02