Mutagenetix > Incidental Mutation

Incidental Mutation 'R8324:Itpr2'

643983

Institutional Source

Beutler Lab

Gene Symbol

Itpr2

Ensembl Gene

ENSMUSG00000030287

Gene Name

inositol 1,4,5-triphosphate receptor 2

Synonyms

Itpr5, Ip3r2

MMRRC Submission

067725-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8324 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

146108299-146502223 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 146328398 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1233 (E1233G)

Ref Sequence

ENSEMBL: ENSMUSP00000049584 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053273
AA Change: E1233G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: E1233G

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	173	223	8.9e-6	SMART
MIR	231	287	5.11e-6	SMART
MIR	294	402	3.73e-8	SMART
Pfam:RYDR_ITPR	473	670	1.5e-62	PFAM
low complexity region	882	890	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1346	1.6e-16	PFAM
low complexity region	1773	1785	N/A	INTRINSIC
low complexity region	1897	1908	N/A	INTRINSIC
Pfam:RIH_assoc	1912	2022	4.6e-34	PFAM
low complexity region	2088	2098	N/A	INTRINSIC
transmembrane domain	2228	2250	N/A	INTRINSIC
Pfam:Ion_trans	2260	2552	5.1e-20	PFAM
coiled coil region	2631	2686	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000079573
AA Change: E1200G

PolyPhen 2 Score 0.334 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: E1200G

Domain	Start	End	E-Value	Type
low complexity region	68	80	N/A	INTRINSIC
MIR	112	166	1.1e-5	SMART
MIR	198	254	5.11e-6	SMART
MIR	261	369	3.73e-8	SMART
Pfam:RYDR_ITPR	438	644	5.4e-75	PFAM
low complexity region	849	857	N/A	INTRINSIC
Pfam:RYDR_ITPR	1148	1322	7.2e-60	PFAM
low complexity region	1740	1752	N/A	INTRINSIC
Pfam:RIH_assoc	1875	1994	5.8e-35	PFAM
low complexity region	2055	2065	N/A	INTRINSIC
transmembrane domain	2195	2217	N/A	INTRINSIC
transmembrane domain	2230	2249	N/A	INTRINSIC
low complexity region	2268	2279	N/A	INTRINSIC
Pfam:Ion_trans	2281	2507	2.4e-12	PFAM
coiled coil region	2598	2653	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,290,395	S753P	probably damaging	Het
Acan	A	G	7: 79,091,056	E390G	probably damaging	Het
Antxr2	T	C	5: 97,938,509	N413S	probably damaging	Het
Bace2	C	T	16: 97,356,908	A36V	possibly damaging	Het
Caprin1	G	A	2: 103,783,181	R79*	probably null	Het
Cdan1	A	G	2: 120,727,325	V507A	probably benign	Het
Cdkl3	T	A	11: 52,022,879		probably null	Het
Chst5	A	T	8: 111,890,508	L160Q	probably benign	Het
Col11a1	C	G	3: 114,164,410	P1111R	probably damaging	Het
Col6a6	T	A	9: 105,755,654	E1470D	probably benign	Het
Cpped1	T	A	16: 11,805,476	T274S	probably benign	Het
Ctnnbl1	G	A	2: 157,779,815	E75K	probably damaging	Het
Cyp4f40	T	C	17: 32,659,528	S15P	probably benign	Het
Ddx46	T	C	13: 55,663,914	S643P	probably damaging	Het
Defb34	A	G	8: 19,123,798	Q16R	probably null	Het
Dhrs2	T	A	14: 55,238,764	V147E	probably damaging	Het
Dnah5	G	T	15: 28,346,865	R2498L	probably damaging	Het
Dpp10	T	A	1: 123,854,172	I93F	probably benign	Het
Eef1e1	T	A	13: 38,655,069	D104V	probably damaging	Het
Egfr	A	G	11: 16,858,971	Y55C	probably damaging	Het
Egfr	A	C	11: 16,908,885	I955L	probably damaging	Het
Ehbp1l1	C	A	19: 5,719,998	V426F	possibly damaging	Het
Fam234a	C	T	17: 26,218,698	V108I	probably benign	Het
Fzd8	T	A	18: 9,214,688	M590K	probably damaging	Het
Gm13287	T	C	4: 88,803,638	S129P	probably damaging	Het
Heatr5b	A	G	17: 78,755,364	S1919P	possibly damaging	Het
Hspg2	C	G	4: 137,518,979	P1023A	possibly damaging	Het
Ikbkap	C	T	4: 56,772,491	E877K	probably damaging	Het
Kcnmb4	A	G	10: 116,418,314	L186P	probably damaging	Het
Krt72	T	A	15: 101,782,145	Y224F	probably damaging	Het
Loxhd1	T	C	18: 77,339,579		probably null	Het
Lrguk	A	G	6: 34,102,571	T914A	probably benign	Het
Lrrtm4	A	G	6: 80,021,991	T129A	probably damaging	Het
Mmp13	A	T	9: 7,276,636	I244F	possibly damaging	Het
Mob1a	T	A	6: 83,329,974	L41Q	probably damaging	Het
Mtcl1	T	C	17: 66,436,217	R426G	probably damaging	Het
Mybbp1a	T	C	11: 72,445,288		probably null	Het
Myh9	A	G	15: 77,788,917		probably null	Het
Myo1d	T	A	11: 80,557,521	D926V	probably damaging	Het
Ncapg	T	G	5: 45,695,668	H825Q	probably damaging	Het
Olfml1	T	C	7: 107,590,363	S212P	probably benign	Het
Olfr656	G	A	7: 104,618,114	R145H	probably benign	Het
Pak2	T	C	16: 32,052,211	N51S	probably benign	Het
Papln	T	C	12: 83,786,619	Y1132H	probably damaging	Het
Pax3	T	A	1: 78,193,789	R134S	probably damaging	Het
Pdzrn4	A	G	15: 92,770,937	E990G	probably damaging	Het
Peak1	A	T	9: 56,207,476	W1394R	probably damaging	Het
Pkn2	T	C	3: 142,829,010	N285D	probably benign	Het
Pramef12	A	C	4: 144,395,857	L39R	probably damaging	Het
Prrc2a	A	G	17: 35,156,984	S897P	possibly damaging	Het
Rad51	A	G	2: 119,123,831	T131A	possibly damaging	Het
Rc3h2	T	A	2: 37,400,726	T255S	possibly damaging	Het
Repin1	G	T	6: 48,597,345	E403*	probably null	Het
Rictor	T	A	15: 6,745,562	V125E	probably damaging	Het
Rps6ka5	C	T	12: 100,558,487	D664N	possibly damaging	Het
Rreb1	T	A	13: 37,947,621	W1584R	probably damaging	Het
Rxra	T	C	2: 27,741,183	I142T	probably damaging	Het
Sall2	T	C	14: 52,312,886	T951A	probably benign	Het
Slc15a2	T	G	16: 36,759,307	N359T	probably damaging	Het
Slc23a1	C	T	18: 35,622,535	G436E	probably damaging	Het
Slc6a13	T	C	6: 121,337,414	*603Q	probably null	Het
Sptb	T	C	12: 76,619,162	D894G	possibly damaging	Het
Srgn	A	G	10: 62,507,665	L17P	probably damaging	Het
Tmprss9	T	C	10: 80,897,371		probably null	Het
Trav9n-4	T	C	14: 53,294,946	F86L	probably benign	Het
Trp63	A	G	16: 25,876,734	Y482C	unknown	Het
Ttc9b	G	T	7: 27,653,969	A15S	probably damaging	Het
Urb1	A	T	16: 90,791,190	I410N	probably damaging	Het
Vmn2r82	A	T	10: 79,378,893	K237*	probably null	Het
Wwox	G	A	8: 114,489,005		probably null	Het

Other mutations in Itpr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Itpr2	APN	6	146397012	missense	probably damaging	0.99
IGL00163:Itpr2	APN	6	146390836	missense	possibly damaging	0.88
IGL00229:Itpr2	APN	6	146144185	missense	probably damaging	1.00
IGL00712:Itpr2	APN	6	146232436	missense	possibly damaging	0.63
IGL00952:Itpr2	APN	6	146158961	missense	probably damaging	1.00
IGL00983:Itpr2	APN	6	146310981	splice site	probably benign
IGL01012:Itpr2	APN	6	146345161	missense	probably damaging	1.00
IGL01289:Itpr2	APN	6	146112535	nonsense	probably null
IGL01411:Itpr2	APN	6	146376062	critical splice donor site	probably null
IGL01557:Itpr2	APN	6	146158976	missense	probably damaging	0.99
IGL01669:Itpr2	APN	6	146180229	missense	probably damaging	1.00
IGL01809:Itpr2	APN	6	146227581	missense	probably damaging	1.00
IGL01814:Itpr2	APN	6	146232546	missense	probably benign	0.02
IGL02198:Itpr2	APN	6	146323227	missense	probably damaging	1.00
IGL02218:Itpr2	APN	6	146240262	splice site	probably benign
IGL02332:Itpr2	APN	6	146426542	missense	probably damaging	1.00
IGL02425:Itpr2	APN	6	146391321	missense	probably damaging	0.99
IGL02432:Itpr2	APN	6	146325173	missense	probably benign	0.05
IGL02726:Itpr2	APN	6	146375921	missense	probably benign	0.18
IGL02851:Itpr2	APN	6	146385979	missense	probably damaging	0.99
IGL02933:Itpr2	APN	6	146312904	missense	probably benign
IGL03015:Itpr2	APN	6	146375937	missense	probably benign
IGL03067:Itpr2	APN	6	146325182	missense	probably damaging	1.00
IGL03093:Itpr2	APN	6	146379510	missense	probably damaging	1.00
IGL03214:Itpr2	APN	6	146180244	missense	probably benign	0.02
IGL03275:Itpr2	APN	6	146158877	splice site	probably benign
IGL03332:Itpr2	APN	6	146144149	missense	probably damaging	0.98
IGL03352:Itpr2	APN	6	146157104	missense	probably damaging	1.00
IGL03377:Itpr2	APN	6	146329715	missense	probably damaging	0.96
IGL03377:Itpr2	APN	6	146329758	missense	probably benign
dollar_short	UTSW	6	146397019	nonsense	probably null
enfermos	UTSW	6	146234006	missense	probably damaging	0.98
Hopla	UTSW	6	146194598	missense	probably damaging	0.98
P0029:Itpr2	UTSW	6	146379489	missense	probably damaging	1.00
PIT4431001:Itpr2	UTSW	6	146354720	missense	probably benign
PIT4453001:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
PIT4504001:Itpr2	UTSW	6	146229871	missense	probably damaging	0.99
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0040:Itpr2	UTSW	6	146345140	missense	probably damaging	1.00
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0048:Itpr2	UTSW	6	146232291	splice site	probably null
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0055:Itpr2	UTSW	6	146323133	missense	probably benign	0.42
R0088:Itpr2	UTSW	6	146241185	missense	probably benign
R0089:Itpr2	UTSW	6	146350022	critical splice donor site	probably null
R0114:Itpr2	UTSW	6	146312879	missense	probably damaging	1.00
R0125:Itpr2	UTSW	6	146240453	missense	probably benign	0.00
R0144:Itpr2	UTSW	6	146327155	missense	probably damaging	0.98
R0180:Itpr2	UTSW	6	146501909	start gained	probably benign
R0211:Itpr2	UTSW	6	146194613	missense	probably benign	0.17
R0305:Itpr2	UTSW	6	146311103	missense	possibly damaging	0.63
R0367:Itpr2	UTSW	6	146234008	missense	probably damaging	1.00
R0374:Itpr2	UTSW	6	146359392	missense	probably benign	0.00
R0391:Itpr2	UTSW	6	146229773	missense	probably damaging	1.00
R0450:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0464:Itpr2	UTSW	6	146375889	missense	probably damaging	1.00
R0510:Itpr2	UTSW	6	146417979	missense	possibly damaging	0.66
R0532:Itpr2	UTSW	6	146112400	missense	probably damaging	1.00
R0625:Itpr2	UTSW	6	146166651	missense	probably benign
R0633:Itpr2	UTSW	6	146374456	missense	probably damaging	1.00
R0636:Itpr2	UTSW	6	146171412	missense	probably damaging	1.00
R1086:Itpr2	UTSW	6	146350045	missense	probably damaging	1.00
R1352:Itpr2	UTSW	6	146111742	missense	probably damaging	1.00
R1631:Itpr2	UTSW	6	146180290	missense	probably damaging	1.00
R1655:Itpr2	UTSW	6	146376148	missense	probably damaging	1.00
R1767:Itpr2	UTSW	6	146350068	missense	possibly damaging	0.91
R1779:Itpr2	UTSW	6	146158901	nonsense	probably null
R1796:Itpr2	UTSW	6	146296673	missense	probably benign
R1815:Itpr2	UTSW	6	146359416	missense	probably benign	0.08
R1827:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1828:Itpr2	UTSW	6	146328332	missense	probably damaging	1.00
R1884:Itpr2	UTSW	6	146385971	missense	probably benign	0.16
R1902:Itpr2	UTSW	6	146229703	missense	probably damaging	1.00
R1931:Itpr2	UTSW	6	146240354	missense	probably benign	0.41
R1964:Itpr2	UTSW	6	146111693	missense	probably damaging	1.00
R2010:Itpr2	UTSW	6	146227524	splice site	probably null
R2168:Itpr2	UTSW	6	146111678	missense	probably benign	0.05
R2179:Itpr2	UTSW	6	146375966	missense	probably benign
R2290:Itpr2	UTSW	6	146422828	missense	probably damaging	1.00
R2874:Itpr2	UTSW	6	146426498	missense	possibly damaging	0.73
R2888:Itpr2	UTSW	6	146171293	missense	probably damaging	1.00
R2897:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2897:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R2898:Itpr2	UTSW	6	146173341	missense	probably benign	0.03
R2898:Itpr2	UTSW	6	146323169	missense	probably damaging	1.00
R3024:Itpr2	UTSW	6	146180310	missense	probably benign	0.35
R3104:Itpr2	UTSW	6	146312837	critical splice donor site	probably null
R3607:Itpr2	UTSW	6	146227601	missense	probably damaging	0.98
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3732:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3733:Itpr2	UTSW	6	146382700	missense	probably damaging	1.00
R3792:Itpr2	UTSW	6	146415354	missense	probably damaging	1.00
R3806:Itpr2	UTSW	6	146232291	splice site	probably null
R3821:Itpr2	UTSW	6	146417726	missense	probably damaging	1.00
R3929:Itpr2	UTSW	6	146374359	splice site	probably null
R3958:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3959:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R3960:Itpr2	UTSW	6	146229764	missense	probably damaging	1.00
R3960:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4074:Itpr2	UTSW	6	146373244	splice site	probably null
R4085:Itpr2	UTSW	6	146144248	missense	probably damaging	1.00
R4114:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4115:Itpr2	UTSW	6	146425510	missense	probably damaging	0.97
R4588:Itpr2	UTSW	6	146241196	missense	probably benign	0.33
R4663:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4673:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4684:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4686:Itpr2	UTSW	6	146229775	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4713:Itpr2	UTSW	6	146396958	missense	probably damaging	1.00
R4729:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4732:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4733:Itpr2	UTSW	6	146373173	missense	probably damaging	1.00
R4801:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4802:Itpr2	UTSW	6	146371331	missense	probably damaging	1.00
R4877:Itpr2	UTSW	6	146325205	missense	probably damaging	1.00
R4970:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R4986:Itpr2	UTSW	6	146240342	missense	probably damaging	0.96
R5112:Itpr2	UTSW	6	146233991	missense	possibly damaging	0.95
R5200:Itpr2	UTSW	6	146144107	critical splice donor site	probably null
R5224:Itpr2	UTSW	6	146166651	missense	probably benign
R5243:Itpr2	UTSW	6	146187546	missense	probably damaging	1.00
R5348:Itpr2	UTSW	6	146476693	missense	possibly damaging	0.78
R5393:Itpr2	UTSW	6	146376155	nonsense	probably null
R5552:Itpr2	UTSW	6	146294080	missense	probably benign
R5579:Itpr2	UTSW	6	146173366	nonsense	probably null
R5744:Itpr2	UTSW	6	146376151	missense	probably damaging	1.00
R5825:Itpr2	UTSW	6	146144149	missense	probably damaging	0.98
R5910:Itpr2	UTSW	6	146329571	missense	probably benign	0.10
R5911:Itpr2	UTSW	6	146312943	missense	probably benign	0.42
R6044:Itpr2	UTSW	6	146396951	missense	probably null	0.98
R6072:Itpr2	UTSW	6	146347111	missense	probably damaging	0.98
R6191:Itpr2	UTSW	6	146328335	missense	probably benign	0.01
R6483:Itpr2	UTSW	6	146112477	missense	possibly damaging	0.52
R6511:Itpr2	UTSW	6	146329727	missense	probably damaging	1.00
R6524:Itpr2	UTSW	6	146345211	missense	probably benign	0.01
R6561:Itpr2	UTSW	6	146234006	missense	probably damaging	0.98
R6594:Itpr2	UTSW	6	146190480	missense	possibly damaging	0.71
R6603:Itpr2	UTSW	6	146347171	missense	probably damaging	0.98
R6736:Itpr2	UTSW	6	146325170	missense	probably damaging	1.00
R6783:Itpr2	UTSW	6	146385873	critical splice donor site	probably null
R6831:Itpr2	UTSW	6	146112429	missense	probably damaging	1.00
R6857:Itpr2	UTSW	6	146397019	nonsense	probably null
R7103:Itpr2	UTSW	6	146325074	missense	probably damaging	1.00
R7111:Itpr2	UTSW	6	146325056	missense	probably damaging	1.00
R7126:Itpr2	UTSW	6	146357796	nonsense	probably null
R7165:Itpr2	UTSW	6	146294091	missense	probably damaging	1.00
R7184:Itpr2	UTSW	6	146311087	missense	possibly damaging	0.79
R7249:Itpr2	UTSW	6	146311052	missense	probably damaging	1.00
R7292:Itpr2	UTSW	6	146158949	missense	possibly damaging	0.95
R7342:Itpr2	UTSW	6	146327187	missense	probably damaging	0.98
R7392:Itpr2	UTSW	6	146359340	missense	possibly damaging	0.95
R7414:Itpr2	UTSW	6	146373208	missense	probably benign	0.06
R7448:Itpr2	UTSW	6	146329508	missense	probably damaging	1.00
R7492:Itpr2	UTSW	6	146390938	missense	probably damaging	1.00
R7515:Itpr2	UTSW	6	146327110	missense	probably damaging	1.00
R7529:Itpr2	UTSW	6	146194598	missense	probably damaging	0.98
R7558:Itpr2	UTSW	6	146390865	missense	probably damaging	1.00
R7650:Itpr2	UTSW	6	146233994	missense	probably benign	0.36
R7678:Itpr2	UTSW	6	146187550	missense	probably benign	0.00
R7790:Itpr2	UTSW	6	146224776	missense	probably damaging	1.00
R7798:Itpr2	UTSW	6	146386015	missense	probably benign	0.06
R7831:Itpr2	UTSW	6	146291584	missense	probably benign	0.04
R8023:Itpr2	UTSW	6	146187490	missense	probably damaging	0.97
R8046:Itpr2	UTSW	6	146426459	missense	probably damaging	0.96
R8236:Itpr2	UTSW	6	146390783	critical splice donor site	probably null
R8241:Itpr2	UTSW	6	146418515	missense	possibly damaging	0.90
R8245:Itpr2	UTSW	6	146373106	missense	probably damaging	0.98
R8339:Itpr2	UTSW	6	146312898	missense	probably benign	0.19
R8458:Itpr2	UTSW	6	146233966	missense	possibly damaging	0.62
R8506:Itpr2	UTSW	6	146418416	critical splice donor site	probably null
R8529:Itpr2	UTSW	6	146329553	missense	probably damaging	1.00
R8672:Itpr2	UTSW	6	146374518	missense	probably damaging	1.00
R8755:Itpr2	UTSW	6	146232428	missense	probably benign
R8816:Itpr2	UTSW	6	146241212	missense	probably damaging	0.98
R9160:Itpr2	UTSW	6	146374601	missense	probably damaging	1.00
R9273:Itpr2	UTSW	6	146325031	missense	probably damaging	1.00
R9284:Itpr2	UTSW	6	146354676	missense	probably benign	0.01
R9322:Itpr2	UTSW	6	146325089	missense	probably benign	0.19
R9357:Itpr2	UTSW	6	146359316	missense	probably damaging	1.00
R9424:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
R9438:Itpr2	UTSW	6	146166668	missense	probably benign
R9576:Itpr2	UTSW	6	146311007	missense	probably damaging	0.98
V8831:Itpr2	UTSW	6	146385882	missense	probably damaging	1.00
X0054:Itpr2	UTSW	6	146323236	missense	probably damaging	1.00
X0063:Itpr2	UTSW	6	146180353	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAACTCTATTCGCACTGTGTG -3'
(R):5'- CATGGAGGAAAGCGCCCATG -3'

Sequencing Primer
(F):5'- ACTGTGTGAATCTGACGCAC -3'
(R):5'- GAGTACGTGCTATGTGGGC -3'

Posted On

2020-09-02