Mutagenetix > Incidental Mutations

Incidental Mutation 'R6151:Tenm3'

489267

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

044298-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.707) question?

Stock #

R6151 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 48395573 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glutamine at position 12 (R12Q)

Ref Sequence

ENSEMBL: ENSMUSP00000105975 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110343] [ENSMUST00000110345] [ENSMUST00000110346] [ENSMUST00000190840] [ENSMUST00000211976]

Predicted Effect

probably damaging
Transcript: ENSMUST00000033965
AA Change: R284Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: R284Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110343
AA Change: R12Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105972
Gene: ENSMUSG00000031561
AA Change: R12Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	2.3e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110345
AA Change: R12Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105974
Gene: ENSMUSG00000031561
AA Change: R12Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	2.3e-15	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110346
AA Change: R12Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561
AA Change: R12Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	1	36	1.1e-14	PFAM
transmembrane domain	37	59	N/A	INTRINSIC
EGF	245	273	2.32e-1	SMART
EGF_like	276	304	4.11e1	SMART
EGF	309	338	1.69e1	SMART
EGF	341	370	1.35e-2	SMART
EGF	375	405	6.11e-1	SMART
EGF	408	436	7.95e0	SMART
EGF	439	467	1.28e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190840
AA Change: R284Q

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: R284Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000211976
AA Change: R77Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 99 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	T	13: 66,431,681	C248S	probably damaging	Het
3110009E18Rik	A	G	1: 120,171,486		probably null	Het
4930550C14Rik	G	T	9: 53,414,383	R73S	probably damaging	Het
Abca1	A	G	4: 53,085,261	V517A	probably benign	Het
Adck5	A	T	15: 76,594,687	K370N	possibly damaging	Het
Akap6	A	C	12: 53,025,792	D981A	probably damaging	Het
Apbb1	G	A	7: 105,574,252	R51*	probably null	Het
Arhgap23	A	G	11: 97,500,412	M1252V	probably benign	Het
Arhgef1	A	G	7: 24,917,942	T354A	probably benign	Het
Arid1a	G	T	4: 133,684,976	Q1636K	unknown	Het
Asmt	C	T	X: 170,676,467	A237V	possibly damaging	Het
Brat1	T	A	5: 140,705,961	C43S	probably benign	Het
Cd36	T	C	5: 17,795,595	Y370C	probably damaging	Het
Ceacam12	A	T	7: 18,069,105	L145F	probably benign	Het
Col24a1	C	T	3: 145,314,054	T62I	probably damaging	Het
Col6a3	G	T	1: 90,813,753	N652K	possibly damaging	Het
Dcbld1	T	C	10: 52,304,660	L140P	probably damaging	Het
Dhrs13	G	A	11: 78,036,982	C218Y	probably damaging	Het
Diaph1	T	G	18: 37,853,353	E1158A	probably damaging	Het
Emp2	A	C	16: 10,292,281	F20C	probably damaging	Het
Enpep	T	C	3: 129,332,418	I22V	possibly damaging	Het
Epha2	A	G	4: 141,318,480		probably null	Het
Eprs	G	T	1: 185,407,754		probably null	Het
Etl4	T	A	2: 20,713,360	I304N	probably damaging	Het
Exoc3l2	C	A	7: 19,491,745	S89*	probably null	Het
F5	A	T	1: 164,181,635	I325F	probably damaging	Het
F5	G	A	1: 164,190,187	C611Y	probably damaging	Het
Fam133b	A	T	5: 3,559,133	S116C	probably null	Het
Fam13b	A	T	18: 34,494,277	D190E	probably damaging	Het
Fam169a	T	G	13: 97,093,630	Y58D	probably damaging	Het
Far1	G	A	7: 113,561,396	R383H	possibly damaging	Het
Fnbp1l	T	C	3: 122,570,930	K52R	possibly damaging	Het
Foxj3	C	A	4: 119,623,271	Q469K	unknown	Het
Frs3	A	T	17: 47,689,088		probably benign	Het
Gdpd3	A	G	7: 126,775,502	S290G	probably benign	Het
Gm6768	T	G	12: 119,261,106		noncoding transcript	Het
Gmip	T	A	8: 69,817,085	L610Q	probably damaging	Het
Gprc5c	T	A	11: 114,864,025	I176N	probably damaging	Het
Grm3	A	G	5: 9,511,556	F765L	probably damaging	Het
Hhat	A	T	1: 192,759,757	L2Q	probably damaging	Het
Hrasls5	C	T	19: 7,619,291	P148S	probably damaging	Het
Hspbap1	T	C	16: 35,817,222	S214P	probably damaging	Het
Ighv1-62-3	C	A	12: 115,461,289	V21F	probably damaging	Het
Kcnj15	A	T	16: 95,295,668	K50*	probably null	Het
Kidins220	T	C	12: 25,056,909	S1454P	possibly damaging	Het
Kl	T	A	5: 150,988,853	M689K	possibly damaging	Het
Klhl23	T	G	2: 69,824,854	L356R	probably damaging	Het
Kndc1	A	T	7: 139,921,213	D806V	probably benign	Het
Krt26	T	C	11: 99,337,489	E139G	probably benign	Het
Lefty1	T	C	1: 180,935,116	F3L	unknown	Het
Madd	A	C	2: 91,165,457	Y853*	probably null	Het
Map1a	T	A	2: 121,289,823	D63E	probably benign	Het
Mdn1	T	A	4: 32,684,735	V815E	probably damaging	Het
Mettl3	A	G	14: 52,295,020	Y569H	probably damaging	Het
Mknk2	T	C	10: 80,669,025		probably null	Het
Mpp3	C	A	11: 102,008,566	R376S	probably benign	Het
Nup160	T	A	2: 90,690,105	Y293*	probably null	Het
Nupl1	A	T	14: 60,244,616	F100I	possibly damaging	Het
Nxpe2	A	C	9: 48,326,191	L255V	probably benign	Het
Olfr1423	T	C	19: 12,036,736	E2G	probably benign	Het
Olfr167	A	T	16: 19,515,531	L35Q	probably damaging	Het
Olfr390	T	A	11: 73,787,695	Y252*	probably null	Het
Olfr479	A	G	7: 108,055,899	I306V	probably benign	Het
Padi3	A	T	4: 140,796,394	D248E	probably damaging	Het
Paxip1	G	T	5: 27,761,618	H637N	probably damaging	Het
Pde4b	T	A	4: 102,601,551	M296K	probably damaging	Het
Pkd1	A	G	17: 24,575,606	H2089R	probably benign	Het
Prpf40a	T	C	2: 53,157,915	M197V	probably benign	Het
Rhebl1	T	C	15: 98,878,279	I165V	probably benign	Het
Rock1	A	T	18: 10,106,426	V481E	possibly damaging	Het
Rtca	T	A	3: 116,507,827	T24S	probably benign	Het
Serpina3c	T	A	12: 104,152,068	I4F	possibly damaging	Het
Serpina3j	C	A	12: 104,317,390	A249E	possibly damaging	Het
Slc38a9	A	G	13: 112,689,376	N116S	probably damaging	Het
Slco2b1	C	T	7: 99,690,563	V58I	possibly damaging	Het
Slfn8	T	A	11: 83,017,321	Y132F	probably damaging	Het
Smg6	T	G	11: 75,156,207	I1242S	probably damaging	Het
Tap2	G	T	17: 34,212,047	V374L	probably benign	Het
Tbc1d10b	G	A	7: 127,207,996	T123M	probably damaging	Het
Tenm2	A	C	11: 36,008,783	V2516G	probably damaging	Het
Tmem130	T	A	5: 144,737,851	M355L	probably benign	Het
Tns4	C	T	11: 99,075,550	S433N	probably benign	Het
Traip	G	T	9: 107,970,619		probably null	Het
Trmo	G	A	4: 46,389,390	R2C	probably damaging	Het
Ttn	A	T	2: 76,944,160	I2134N	probably damaging	Het
Uba1y	A	G	Y: 825,984	D380G	probably benign	Het
Ube2t	T	A	1: 134,967,960		probably null	Het
Ugdh	A	T	5: 65,417,581	Y367*	probably null	Het
Usp45	A	C	4: 21,810,797	D331A	probably damaging	Het
Vmn1r84	G	T	7: 12,361,914	T284K	possibly damaging	Het
Vmn1r91	T	A	7: 20,101,435	F93Y	probably benign	Het
Vmn2r77	T	A	7: 86,801,670	Y255N	probably benign	Het
Vmn2r96	A	T	17: 18,583,959	Q490H	probably benign	Het
Vwa2	A	G	19: 56,903,465		probably null	Het
Vwf	A	G	6: 125,657,065	K169E	unknown	Het
Zc3h7b	G	C	15: 81,778,710		probably null	Het
Zfp458	T	A	13: 67,257,598	H259L	possibly damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het
Zfp804b	A	G	5: 6,769,910	V1051A	probably benign	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1768:Tenm3	UTSW	8	48232104	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7926:Tenm3	UTSW	8	48229111	nonsense	probably null
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACCAAGCAAGTTTTCCTACTTATTG -3'
(R):5'- TCCCTATGTGTCTATGTGAACATATTC -3'

Sequencing Primer
(F):5'- TATTCAAGACCAAACAAGACTAACAG -3'
(R):5'- GTGAACATATTCCTGTCTTACCATG -3'

Posted On

2017-10-10