Mutagenetix > Incidental Mutation

Incidental Mutation 'R9752:Cr2'

732550

Institutional Source

Beutler Lab

Gene Symbol

Cr2

Ensembl Gene

ENSMUSG00000026616

Gene Name

complement receptor 2

Synonyms

C3DR, CD21, Cr-1, Cr1, CD35, Cr-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R9752 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

195136811-195176716 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 195141267 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1008 (T1008A)

Ref Sequence

ENSEMBL: ENSMUSP00000080938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000082321
AA Change: T1008A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: T1008A

Domain	Start	End	E-Value	Type
CCP	23	82	1.01e-11	SMART
CCP	91	147	9.1e-14	SMART
CCP	155	211	1.9e-16	SMART
CCP	216	272	1.6e-9	SMART
CCP	277	343	1.01e-11	SMART
CCP	352	407	1.2e-13	SMART
CCP	411	467	2.34e-16	SMART
CCP	472	523	1.24e0	SMART
CCP	528	594	4.48e-13	SMART
CCP	603	658	1.95e-13	SMART
CCP	718	778	1.75e-15	SMART
CCP	787	842	2.06e-12	SMART
CCP	850	906	7.92e-14	SMART
CCP	911	967	1.29e-13	SMART
transmembrane domain	975	997	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193356
AA Change: T711A

PolyPhen 2 Score 0.366 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: T711A

Domain	Start	End	E-Value	Type
CCP	1	46	1.2e-1	SMART
CCP	55	110	5.9e-16	SMART
CCP	114	170	1.1e-18	SMART
CCP	175	226	6.1e-3	SMART
CCP	231	297	2.2e-15	SMART
CCP	306	361	9.4e-16	SMART
CCP	421	481	8.3e-18	SMART
CCP	490	545	1e-14	SMART
CCP	553	609	4e-16	SMART
CCP	614	670	6.2e-16	SMART
transmembrane domain	678	700	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000193801

SMART Domains

Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000195120
AA Change: D1009G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: D1009G

Domain	Start	End	E-Value	Type
CCP	23	82	4.9e-14	SMART
CCP	91	147	4.5e-16	SMART
CCP	155	211	9.1e-19	SMART
CCP	216	272	8e-12	SMART
CCP	277	343	5e-14	SMART
CCP	352	407	5.9e-16	SMART
CCP	411	467	1.1e-18	SMART
CCP	472	523	6.1e-3	SMART
CCP	528	594	2.2e-15	SMART
CCP	603	658	9.4e-16	SMART
CCP	718	778	8.3e-18	SMART
CCP	787	842	1e-14	SMART
CCP	850	906	4e-16	SMART
CCP	911	967	6.2e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000210219
AA Change: T1384A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 99.3%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	T	A	6: 149,326,570	N371K	probably benign	Het
Ano2	C	T	6: 125,863,536	T390I	probably damaging	Het
Cc2d2b	T	C	19: 40,792,827	V772A	probably damaging	Het
Cd109	A	G	9: 78,707,552	I1294V	probably benign	Het
Cic	A	G	7: 25,271,978	E378G	probably damaging	Het
Clhc1	C	T	11: 29,557,778	P175L	probably benign	Het
Clip1	T	C	5: 123,621,946	E783G	probably damaging	Het
Cnot1	A	G	8: 95,761,391	Y546H	probably damaging	Het
Cog7	C	A	7: 121,981,416		probably null	Het
Diaph1	T	C	18: 37,903,071	T196A	unknown	Het
Flg2	A	T	3: 93,201,160	D165V	probably damaging	Het
Fstl1	T	G	16: 37,829,172	N249K	probably damaging	Het
Gatad2a	A	G	8: 69,912,189	V515A	probably benign	Het
Gbp2b	A	T	3: 142,608,156	D399V	probably benign	Het
Gna14	G	A	19: 16,609,417	V319I	probably benign	Het
Grip1	A	G	10: 120,035,351	D661G	possibly damaging	Het
Gtf3c4	C	A	2: 28,834,114	L535F	probably damaging	Het
Haus8	A	C	8: 71,263,087	S36A	probably damaging	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hectd4	C	T	5: 121,334,352	A2717V	possibly damaging	Het
Hsf5	C	T	11: 87,622,883	T258M	probably benign	Het
Ifi209	A	T	1: 173,644,669	I359F	probably damaging	Het
Ighmbp2	A	G	19: 3,274,360	V302A	probably benign	Het
Iqgap3	C	A	3: 88,108,869	F986L	probably damaging	Het
Itgav	T	A	2: 83,770,107		probably null	Het
Kcp	A	T	6: 29,497,755	D502E	probably damaging	Het
Kif15	T	C	9: 122,995,825		probably null	Het
Lipo2	C	G	19: 33,745,821	K189N	possibly damaging	Het
Lrch4	T	A	5: 137,637,956	S390T	probably benign	Het
Mast2	G	T	4: 116,322,311	H389N	probably benign	Het
Med13	A	G	11: 86,283,321	Y1784H	possibly damaging	Het
Micu3	A	G	8: 40,380,710	K462E	possibly damaging	Het
Mrps10	T	C	17: 47,372,647		probably null	Het
Msh6	T	C	17: 87,986,535	L906P	probably damaging	Het
Nphp4	A	G	4: 152,537,280	E531G	probably benign	Het
Nrp2	A	T	1: 62,812,567	Y825F	probably benign	Het
Ntn1	C	T	11: 68,385,886	V79M	possibly damaging	Het
Nxnl2	A	G	13: 51,171,471	D50G	probably damaging	Het
Olfr1	T	A	11: 73,395,653	Y123F	possibly damaging	Het
Olfr1395	T	C	11: 49,148,854	M199T	probably benign	Het
Olfr584	T	A	7: 103,086,462	C310S	probably benign	Het
Olfr651	A	T	7: 104,553,323	I135F	possibly damaging	Het
Olfr818	T	C	10: 129,945,121	R314G	probably benign	Het
Olfr872	G	A	9: 20,259,908	V23I	probably benign	Het
Ppp1r42	A	G	1: 10,003,449		probably benign	Het
Ppp4r3a	A	T	12: 101,042,504	N692K	probably benign	Het
Prr11	T	C	11: 87,103,590	T77A	possibly damaging	Het
Rrn3	A	G	16: 13,813,231	I644V	probably benign	Het
Scd4	T	C	19: 44,334,036	S23P	probably benign	Het
Sdccag3	T	C	2: 26,386,978	N247D	probably benign	Het
Slc26a2	T	A	18: 61,201,938	S148C	probably benign	Het
Slc7a8	T	C	14: 54,758,474	E157G	probably benign	Het
Spi1	A	G	2: 91,113,321	H70R	probably benign	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Tlr4	A	G	4: 66,839,675	N235S	probably benign	Het
Trpc6	C	A	9: 8,643,640	S475R	probably benign	Het
Usp34	C	T	11: 23,459,182	P2674L	probably benign	Het
Usp48	G	A	4: 137,613,826	G379D	probably damaging	Het
Vkorc1l1	T	A	5: 129,982,237	C97*	probably null	Het
Wfikkn2	T	C	11: 94,238,385	E310G	probably benign	Het
Zfp266	T	A	9: 20,500,200	N227I	probably benign	Het
Zfp335	C	T	2: 164,907,427		probably null	Het
Zfp677	T	A	17: 21,398,249	C523S	probably damaging	Het
Zrsr2	GCTCCTCCTCCTCCTCCT	GCTCCTCCTCCTCCT	X: 163,936,754		probably benign	Het

Other mutations in Cr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00587:Cr2	APN	1	195154251	missense	possibly damaging	0.76
IGL01326:Cr2	APN	1	195141221	missense	probably null	1.00
IGL01358:Cr2	APN	1	195159820	missense	probably damaging	1.00
IGL01410:Cr2	APN	1	195163234	missense	possibly damaging	0.49
IGL01468:Cr2	APN	1	195168535	missense	probably damaging	1.00
IGL01608:Cr2	APN	1	195155220	missense	possibly damaging	0.50
IGL01810:Cr2	APN	1	195159595	missense	possibly damaging	0.49
IGL01843:Cr2	APN	1	195150914	splice site	probably benign
IGL02332:Cr2	APN	1	195160322	missense	probably benign	0.19
IGL02934:Cr2	APN	1	195154325	splice site	probably benign
IGL02938:Cr2	APN	1	195166388	missense	probably damaging	1.00
IGL03149:Cr2	APN	1	195166366	missense	probably damaging	1.00
IGL03327:Cr2	APN	1	195169759	missense	probably damaging	1.00
IGL03346:Cr2	APN	1	195169759	missense	probably damaging	1.00
Pillar	UTSW	1	195155888	nonsense	probably null
PIT4354001:Cr2	UTSW	1	195166309	missense	probably damaging	1.00
PIT4418001:Cr2	UTSW	1	195157452	missense	probably benign	0.08
R0128:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0130:Cr2	UTSW	1	195166231	missense	probably damaging	0.99
R0380:Cr2	UTSW	1	195157407	missense	probably damaging	1.00
R0538:Cr2	UTSW	1	195160359	splice site	probably benign
R0605:Cr2	UTSW	1	195163596	splice site	probably benign
R0626:Cr2	UTSW	1	195171111	missense	possibly damaging	0.95
R1135:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R1396:Cr2	UTSW	1	195169253	splice site	probably null
R1422:Cr2	UTSW	1	195171125	missense	probably benign	0.01
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1467:Cr2	UTSW	1	195157509	missense	probably damaging	1.00
R1511:Cr2	UTSW	1	195155272	missense	possibly damaging	0.92
R1572:Cr2	UTSW	1	195163314	missense	probably damaging	1.00
R1714:Cr2	UTSW	1	195151686	missense	possibly damaging	0.46
R1748:Cr2	UTSW	1	195155905	nonsense	probably null
R1761:Cr2	UTSW	1	195155123	critical splice donor site	probably null
R1824:Cr2	UTSW	1	195157316	missense	probably damaging	1.00
R1893:Cr2	UTSW	1	195155187	missense	probably benign	0.03
R1990:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1991:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R1992:Cr2	UTSW	1	195154150	missense	possibly damaging	0.63
R2191:Cr2	UTSW	1	195163381	missense	possibly damaging	0.94
R2276:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R2277:Cr2	UTSW	1	195157368	missense	possibly damaging	0.94
R3548:Cr2	UTSW	1	195155888	nonsense	probably null
R3743:Cr2	UTSW	1	195149966	splice site	probably benign
R3941:Cr2	UTSW	1	195165814	missense	probably damaging	0.97
R3963:Cr2	UTSW	1	195159739	missense	probably damaging	1.00
R4211:Cr2	UTSW	1	195156328	missense	probably damaging	0.96
R4484:Cr2	UTSW	1	195154174	missense	probably damaging	1.00
R4546:Cr2	UTSW	1	195171041	missense	possibly damaging	0.94
R4791:Cr2	UTSW	1	195155935	missense	probably damaging	1.00
R4801:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4802:Cr2	UTSW	1	195163311	missense	probably damaging	1.00
R4874:Cr2	UTSW	1	195176570	missense	possibly damaging	0.82
R4885:Cr2	UTSW	1	195158731	missense	possibly damaging	0.92
R4889:Cr2	UTSW	1	195176585	missense	possibly damaging	0.70
R5154:Cr2	UTSW	1	195159446	missense	probably damaging	1.00
R5574:Cr2	UTSW	1	195141236	missense	probably damaging	1.00
R5594:Cr2	UTSW	1	195157190	missense	probably damaging	1.00
R5645:Cr2	UTSW	1	195154273	missense	probably damaging	1.00
R5700:Cr2	UTSW	1	195159757	missense	probably damaging	0.96
R5929:Cr2	UTSW	1	195171111	missense	possibly damaging	0.91
R6237:Cr2	UTSW	1	195157502	missense	probably damaging	1.00
R6299:Cr2	UTSW	1	195168646	missense	probably damaging	1.00
R6368:Cr2	UTSW	1	195168472	missense	probably damaging	1.00
R6406:Cr2	UTSW	1	195169771	missense	probably damaging	1.00
R6618:Cr2	UTSW	1	195157379	missense	probably damaging	0.98
R6684:Cr2	UTSW	1	195171021	nonsense	probably null
R6720:Cr2	UTSW	1	195155200	missense	probably damaging	0.97
R6866:Cr2	UTSW	1	195151691	missense	probably damaging	1.00
R6915:Cr2	UTSW	1	195171146	missense	probably benign	0.06
R7057:Cr2	UTSW	1	195151610	missense	possibly damaging	0.83
R7117:Cr2	UTSW	1	195160601	missense	possibly damaging	0.79
R7200:Cr2	UTSW	1	195163249	missense	probably damaging	1.00
R7209:Cr2	UTSW	1	195168724	missense	probably damaging	1.00
R7350:Cr2	UTSW	1	195155286	missense	probably benign	0.21
R7414:Cr2	UTSW	1	195150036	missense	probably benign
R7453:Cr2	UTSW	1	195165257	splice site	probably null
R7479:Cr2	UTSW	1	195158410	critical splice donor site	probably null
R7480:Cr2	UTSW	1	195154176	missense	probably damaging	1.00
R7570:Cr2	UTSW	1	195169340	nonsense	probably null
R7666:Cr2	UTSW	1	195154225	missense	probably damaging	1.00
R7921:Cr2	UTSW	1	195151667	missense	possibly damaging	0.94
R7923:Cr2	UTSW	1	195168687	missense	probably benign	0.03
R8396:Cr2	UTSW	1	195158068	missense	probably damaging	1.00
R8503:Cr2	UTSW	1	195163542	missense	probably benign
R8517:Cr2	UTSW	1	195155899	missense	probably benign	0.03
R8773:Cr2	UTSW	1	195158605	missense	probably damaging	1.00
R8849:Cr2	UTSW	1	195157239	missense	probably damaging	1.00
R8896:Cr2	UTSW	1	195169273	missense	possibly damaging	0.58
R8938:Cr2	UTSW	1	195171116	missense	probably damaging	0.99
R9027:Cr2	UTSW	1	195151721	missense	probably benign	0.08
R9045:Cr2	UTSW	1	195155372	missense	possibly damaging	0.61
R9116:Cr2	UTSW	1	195158669	nonsense	probably null
R9137:Cr2	UTSW	1	195168332	critical splice donor site	probably null
R9476:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9497:Cr2	UTSW	1	195168435	missense	probably damaging	0.99
R9510:Cr2	UTSW	1	195158108	missense	probably damaging	0.97
R9799:Cr2	UTSW	1	195160680	missense	probably benign	0.02
X0028:Cr2	UTSW	1	195149982	missense	probably benign	0.09
X0066:Cr2	UTSW	1	195166321	missense	probably damaging	0.99
Z1176:Cr2	UTSW	1	195154153	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TCAGTTGGAATATGAAGTAGGTAAGCT -3'
(R):5'- AATTGGGGCCTATGCTGTTTAATAT -3'

Sequencing Primer
(F):5'- TTTCCTTAAGGCCATGATTTA -3'
(R):5'- CTGACAGCTAATGAATCCTTA -3'

Posted On

2022-11-14