Incidental Mutation 'R9744:Psme4'
ID 731989
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Name proteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_134013

Essential gene? Non essential (E-score: 0.000) question?
Stock # R9744 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 30771726-30880361 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 30815294 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
AlphaFold Q5SSW2
Predicted Effect probably null
Transcript: ENSMUST00000041231
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam7 T A 14: 68,505,134 M677L probably benign Het
Ankrd24 T G 10: 81,647,117 D966E possibly damaging Het
Arhgef28 A G 13: 97,957,753 L961P probably damaging Het
Atxn1 G A 13: 45,567,823 Q199* probably null Het
Bcl2a1c G A 9: 114,330,273 V40I probably benign Het
Cep41 A G 6: 30,656,604 V283A probably benign Het
Cerk A G 15: 86,149,290 Y311H probably damaging Het
Ciz1 A T 2: 32,363,847 Q13L unknown Het
Cpeb2 T C 5: 43,233,925 S155P Het
Dmbx1 T A 4: 115,920,065 E200D probably damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Erc1 T C 6: 119,743,399 Y747C probably damaging Het
Fhad1 T C 4: 141,909,813 E1114G probably damaging Het
Fndc3a C A 14: 72,540,253 E1171* probably null Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
Gys2 A C 6: 142,448,461 D450E probably benign Het
Hmcn1 A T 1: 150,748,190 I1120N probably damaging Het
Ints3 G T 3: 90,411,298 T210K probably damaging Het
Itih5 T C 2: 10,251,410 Y896H probably damaging Het
Kcna7 A G 7: 45,406,978 D206G probably benign Het
Klhl10 T A 11: 100,445,570 C128S probably damaging Het
Klhl5 T C 5: 65,162,912 V603A probably damaging Het
Mapk15 T A 15: 75,998,063 I344N possibly damaging Het
Mdn1 T C 4: 32,715,711 F1993L possibly damaging Het
Myo1c T C 11: 75,671,971 L959P probably damaging Het
Nectin1 A G 9: 43,803,943 Q492R probably damaging Het
Nlrp14 A T 7: 107,197,780 L951F probably damaging Het
Nlrp5 T G 7: 23,421,477 S705R possibly damaging Het
Nlrp9a A G 7: 26,567,841 Y787C probably benign Het
Npsr1 A G 9: 24,289,886 T189A probably benign Het
Nup205 T C 6: 35,232,575 Y1606H probably damaging Het
Olfr1298 C A 2: 111,645,319 R226L probably benign Het
Olfr1346 A T 7: 6,474,211 I34L probably benign Het
Olfr1362 A G 13: 21,611,657 F104S possibly damaging Het
Pitx2 A T 3: 129,215,818 T129S probably damaging Het
Pla2g2c T C 4: 138,743,661 S118P probably damaging Het
Polr1a A G 6: 71,929,388 N396S probably benign Het
Prl A T 13: 27,064,355 Q135L probably benign Het
Prrc2c A G 1: 162,678,164 L2555P possibly damaging Het
Psg29 A T 7: 17,210,570 D335V probably benign Het
Ramp2 T A 11: 101,247,087 S52T unknown Het
Skint6 C T 4: 112,809,163 G1155D probably damaging Het
Sorcs1 G A 19: 50,226,837 R655C probably damaging Het
Syne1 A G 10: 5,324,184 C1867R probably benign Het
Tcf21 T C 10: 22,819,827 D26G probably benign Het
Tmem132a G A 19: 10,863,314 P418L probably damaging Het
Tob1 C T 11: 94,214,228 R197C probably damaging Het
Vmn2r110 A G 17: 20,574,586 V607A probably damaging Het
Vmn2r30 A G 7: 7,312,285 S850P possibly damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 splice site probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 splice site probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 splice site probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 splice site probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7679:Psme4 UTSW 11 30878425 missense probably damaging 0.99
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
R8130:Psme4 UTSW 11 30842026 missense probably damaging 1.00
R8323:Psme4 UTSW 11 30843532 missense probably damaging 0.99
R8330:Psme4 UTSW 11 30843583 missense probably benign 0.00
R8363:Psme4 UTSW 11 30812139 missense probably damaging 1.00
R8491:Psme4 UTSW 11 30772161 missense possibly damaging 0.90
R8690:Psme4 UTSW 11 30837319 missense probably benign 0.00
R8696:Psme4 UTSW 11 30809896 missense probably damaging 0.99
R8743:Psme4 UTSW 11 30878467 missense probably damaging 1.00
R8998:Psme4 UTSW 11 30838957 missense possibly damaging 0.78
R9241:Psme4 UTSW 11 30865576 missense probably damaging 1.00
R9657:Psme4 UTSW 11 30838980 missense probably benign 0.00
R9736:Psme4 UTSW 11 30847411 missense probably damaging 0.99
R9746:Psme4 UTSW 11 30876868 nonsense probably null
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTTTATGACAGTATCCAATGC -3'
(R):5'- GTGACAGCCAGGTAAACCTCTATTC -3'

Sequencing Primer
(F):5'- GCATCGACTTGCTTGTT -3'
(R):5'- GCCAGGTAAACCTCTATTCTTATTAC -3'
Posted On 2022-11-14