Incidental Mutation 'R7679:Psme4'
ID592652
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7679 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30878425 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1815 (D1815G)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect probably damaging
Transcript: ENSMUST00000041231
AA Change: D1815G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: D1815G

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 A C 14: 78,514,816 Y206D Het
Atm A T 9: 53,442,497 I2906N probably damaging Het
B4galnt4 T C 7: 141,067,765 V422A probably benign Het
Bod1l TTCAGGGATC TTC 5: 41,820,643 probably null Het
Ccar2 G A 14: 70,139,235 Q887* probably null Het
Cdh13 A G 8: 119,236,919 I413V probably benign Het
Cfap54 A G 10: 92,967,512 V1556A probably benign Het
Chchd7 A T 4: 3,941,297 N14Y probably damaging Het
Col24a1 C A 3: 145,399,355 T824N possibly damaging Het
Col6a3 A T 1: 90,811,751 Y859N possibly damaging Het
Dnaaf5 C T 5: 139,150,637 P131S unknown Het
Erh T C 12: 80,637,571 N44S probably benign Het
Esm1 T A 13: 113,210,112 D90E probably damaging Het
Fbxo44 A G 4: 148,153,632 F213L probably benign Het
Flnc A G 6: 29,456,790 T2262A probably benign Het
Fmo9 T C 1: 166,667,489 Q281R probably benign Het
Gdpgp1 G T 7: 80,238,576 E118D probably benign Het
Gnas A T 2: 174,284,831 Q53L probably damaging Het
Gpr142 G A 11: 114,806,707 V360M possibly damaging Het
Grn A G 11: 102,433,069 D46G probably benign Het
H2-T10 A G 17: 36,119,324 F242L not run Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Hoxa9 A G 6: 52,224,308 I251T probably damaging Het
Inpp5f C T 7: 128,694,523 T866I possibly damaging Het
Itgb1 T A 8: 128,720,448 N481K probably damaging Het
Leng9 C A 7: 4,149,660 D6Y probably benign Het
Lox A C 18: 52,525,106 F332V possibly damaging Het
Lrp1 G T 10: 127,588,428 Y796* probably null Het
Lrrc32 G A 7: 98,499,687 G558D possibly damaging Het
Lrrk2 A G 15: 91,726,186 E707G possibly damaging Het
Matn4 A G 2: 164,389,658 *625R probably null Het
Mcur1 T A 13: 43,544,483 K314* probably null Het
Med1 G C 11: 98,156,061 P1303R unknown Het
Mgam T C 6: 40,643,046 L23P probably damaging Het
Muc6 G C 7: 141,637,746 P2338R probably damaging Het
Nfatc1 T C 18: 80,607,990 I936V probably benign Het
Nol11 T C 11: 107,173,316 S557G probably benign Het
Palb2 A G 7: 122,128,014 I211T probably benign Het
Pard3 T C 8: 127,371,846 V456A probably benign Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pik3cb T C 9: 99,088,607 K344E probably benign Het
Pik3r3 T A 4: 116,256,195 M45K probably benign Het
Plat G T 8: 22,772,232 G91W probably damaging Het
Pot1a A G 6: 25,771,634 V196A probably benign Het
Ppp1r32 T C 19: 10,482,254 T30A probably damaging Het
Prkdc T A 16: 15,831,319 I3719N probably damaging Het
Psg16 G A 7: 17,093,760 G123S probably damaging Het
Rpe65 C T 3: 159,604,393 T101I probably damaging Het
Rpp25l A C 4: 41,712,326 C150G unknown Het
Serpina1b A T 12: 103,730,515 W212R probably damaging Het
Slc9a3 G A 13: 74,160,276 R466H possibly damaging Het
Sned1 T C 1: 93,236,038 L17P unknown Het
Speg C T 1: 75,406,315 T1056I probably damaging Het
Tada1 T C 1: 166,391,971 F281L probably benign Het
Tbcd G A 11: 121,603,708 V1032I probably benign Het
Tlr3 A T 8: 45,399,051 S270T probably benign Het
Txndc15 G T 13: 55,725,808 R327L probably damaging Het
Zfp169 G C 13: 48,498,383 L66V probably damaging Het
Zfp442 G T 2: 150,410,997 Y45* probably null Het
Zzef1 A G 11: 72,893,278 D2003G probably benign Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 intron probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 intron probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R4714:Psme4 UTSW 11 30832573 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 intron probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7375:Psme4 UTSW 11 30772700 intron probably null
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
R7651:Psme4 UTSW 11 30837334 missense probably damaging 0.98
R7681:Psme4 UTSW 11 30791975 missense possibly damaging 0.63
R7822:Psme4 UTSW 11 30874245 missense probably benign
R8013:Psme4 UTSW 11 30804320 missense probably benign 0.06
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Z1176:Psme4 UTSW 11 30843522 missense possibly damaging 0.87
Z1177:Psme4 UTSW 11 30806311 missense probably damaging 1.00
Z1177:Psme4 UTSW 11 30812138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGTTTAGTGACAGAAAATTGAC -3'
(R):5'- GTCTCATCTTTGCTAAATTTGGGC -3'

Sequencing Primer
(F):5'- ACTTGGTTTTCTAACATTGTGAGAGC -3'
(R):5'- GTGACACATAGCTGCAATCCTAGTG -3'
Posted On2019-11-12