Mutagenetix > Incidental Mutation

Incidental Mutation 'R7679:Psme4'

592652

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7679 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30878425 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1815 (D1815G)

Ref Sequence

ENSEMBL: ENSMUSP00000045460 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably damaging
Transcript: ENSMUST00000041231
AA Change: D1815G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: D1815G

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	A	C	14: 78,514,816	Y206D		Het
Atm	A	T	9: 53,442,497	I2906N	probably damaging	Het
B4galnt4	T	C	7: 141,067,765	V422A	probably benign	Het
Bod1l	TTCAGGGATC	TTC	5: 41,820,643		probably null	Het
Ccar2	G	A	14: 70,139,235	Q887*	probably null	Het
Cdh13	A	G	8: 119,236,919	I413V	probably benign	Het
Cfap54	A	G	10: 92,967,512	V1556A	probably benign	Het
Chchd7	A	T	4: 3,941,297	N14Y	probably damaging	Het
Col24a1	C	A	3: 145,399,355	T824N	possibly damaging	Het
Col6a3	A	T	1: 90,811,751	Y859N	possibly damaging	Het
Dnaaf5	C	T	5: 139,150,637	P131S	unknown	Het
Erh	T	C	12: 80,637,571	N44S	probably benign	Het
Esm1	T	A	13: 113,210,112	D90E	probably damaging	Het
Fbxo44	A	G	4: 148,153,632	F213L	probably benign	Het
Flnc	A	G	6: 29,456,790	T2262A	probably benign	Het
Fmo9	T	C	1: 166,667,489	Q281R	probably benign	Het
Gdpgp1	G	T	7: 80,238,576	E118D	probably benign	Het
Gnas	A	T	2: 174,284,831	Q53L	probably damaging	Het
Gpr142	G	A	11: 114,806,707	V360M	possibly damaging	Het
Grn	A	G	11: 102,433,069	D46G	probably benign	Het
H2-T10	A	G	17: 36,119,324	F242L	not run	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Hoxa9	A	G	6: 52,224,308	I251T	probably damaging	Het
Inpp5f	C	T	7: 128,694,523	T866I	possibly damaging	Het
Itgb1	T	A	8: 128,720,448	N481K	probably damaging	Het
Leng9	C	A	7: 4,149,660	D6Y	probably benign	Het
Lox	A	C	18: 52,525,106	F332V	possibly damaging	Het
Lrp1	G	T	10: 127,588,428	Y796*	probably null	Het
Lrrc32	G	A	7: 98,499,687	G558D	possibly damaging	Het
Lrrk2	A	G	15: 91,726,186	E707G	possibly damaging	Het
Matn4	A	G	2: 164,389,658	*625R	probably null	Het
Mcur1	T	A	13: 43,544,483	K314*	probably null	Het
Med1	G	C	11: 98,156,061	P1303R	unknown	Het
Mgam	T	C	6: 40,643,046	L23P	probably damaging	Het
Muc6	G	C	7: 141,637,746	P2338R	probably damaging	Het
Nfatc1	T	C	18: 80,607,990	I936V	probably benign	Het
Nol11	T	C	11: 107,173,316	S557G	probably benign	Het
Palb2	A	G	7: 122,128,014	I211T	probably benign	Het
Pard3	T	C	8: 127,371,846	V456A	probably benign	Het
Pax2	G	A	19: 44,760,937	V40M	probably damaging	Het
Pik3cb	T	C	9: 99,088,607	K344E	probably benign	Het
Pik3r3	T	A	4: 116,256,195	M45K	probably benign	Het
Plat	G	T	8: 22,772,232	G91W	probably damaging	Het
Pot1a	A	G	6: 25,771,634	V196A	probably benign	Het
Ppp1r32	T	C	19: 10,482,254	T30A	probably damaging	Het
Prkdc	T	A	16: 15,831,319	I3719N	probably damaging	Het
Psg16	G	A	7: 17,093,760	G123S	probably damaging	Het
Rpe65	C	T	3: 159,604,393	T101I	probably damaging	Het
Rpp25l	A	C	4: 41,712,326	C150G	unknown	Het
Serpina1b	A	T	12: 103,730,515	W212R	probably damaging	Het
Slc9a3	G	A	13: 74,160,276	R466H	possibly damaging	Het
Sned1	T	C	1: 93,236,038	L17P	unknown	Het
Speg	C	T	1: 75,406,315	T1056I	probably damaging	Het
Tada1	T	C	1: 166,391,971	F281L	probably benign	Het
Tbcd	G	A	11: 121,603,708	V1032I	probably benign	Het
Tlr3	A	T	8: 45,399,051	S270T	probably benign	Het
Txndc15	G	T	13: 55,725,808	R327L	probably damaging	Het
Zfp169	G	C	13: 48,498,383	L66V	probably damaging	Het
Zfp442	G	T	2: 150,410,997	Y45*	probably null	Het
Zzef1	A	G	11: 72,893,278	D2003G	probably benign	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7375:Psme4	UTSW	11	30772700	splice site	probably null
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTGGTTTAGTGACAGAAAATTGAC -3'
(R):5'- GTCTCATCTTTGCTAAATTTGGGC -3'

Sequencing Primer
(F):5'- ACTTGGTTTTCTAACATTGTGAGAGC -3'
(R):5'- GTGACACATAGCTGCAATCCTAGTG -3'

Posted On

2019-11-12