Incidental Mutation 'R6873:Mast3'
ID 536259
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene? Non essential (E-score: 0.000) question?
Stock # R6873 (G1)
Quality Score 206.009
Status Validated
Chromosome 8
Chromosomal Location 70778117-70805054 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 70786592 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 447 (C447*)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect probably null
Transcript: ENSMUST00000166004
AA Change: C463*
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: C463*

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000211948
AA Change: C447*
Predicted Effect probably benign
Transcript: ENSMUST00000212001
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 98% (48/49)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A G 12: 112,632,704 D123G probably benign Het
Agbl4 A G 4: 111,566,659 D294G possibly damaging Het
Apob G T 12: 8,015,995 M4288I probably benign Het
Arnt T G 3: 95,474,575 F160V probably damaging Het
Atp5a1 C T 18: 77,775,840 R42* probably null Het
Bhlha15 A G 5: 144,191,385 D105G probably benign Het
C6 A G 15: 4,790,979 T491A probably benign Het
Caskin1 A G 17: 24,504,179 E647G probably benign Het
Col11a2 A G 17: 34,065,019 D1579G unknown Het
Dctn2 T G 10: 127,276,236 probably null Het
Eqtn A G 4: 94,927,021 V80A probably damaging Het
Etl4 A G 2: 20,797,992 probably null Het
Fam26e G C 10: 34,092,452 R202G probably damaging Het
Fbxo10 T C 4: 45,041,787 D814G possibly damaging Het
Galnt10 A G 11: 57,781,219 D445G probably damaging Het
Gm13762 T C 2: 88,973,424 T156A probably benign Het
Gm6309 T C 5: 146,168,188 D305G probably damaging Het
Grap2 G A 15: 80,643,673 V107I probably damaging Het
Igsf10 C T 3: 59,328,444 A1439T probably benign Het
Krt5 G A 15: 101,712,877 probably benign Het
Lancl2 A G 6: 57,722,657 I152M possibly damaging Het
Mef2b A G 8: 70,166,307 I180V probably benign Het
Mon1b T C 8: 113,642,065 Y533H probably damaging Het
Mst1r A T 9: 107,911,644 H454L possibly damaging Het
Nhlrc4 G A 17: 25,943,522 Q84* probably null Het
Nlk A G 11: 78,590,948 I229T possibly damaging Het
Nlrp6 T C 7: 140,923,520 I513T probably benign Het
Olfr134 A T 17: 38,175,368 M95L probably benign Het
Olfr340 A T 2: 36,453,496 I304F probably benign Het
Panx1 A T 9: 15,010,217 Y121N probably damaging Het
Pfkfb4 A C 9: 109,010,335 probably null Het
Setbp1 A G 18: 78,859,559 S298P probably benign Het
Sh3bgr A C 16: 96,206,491 K19Q probably damaging Het
Slc35c2 T C 2: 165,282,809 D82G possibly damaging Het
Spata13 T A 14: 60,691,957 D321E probably benign Het
Stab2 A G 10: 86,861,366 probably null Het
Sulf2 T A 2: 166,089,275 I271F probably damaging Het
Sult2a5 A T 7: 13,625,386 I96L probably benign Het
Sv2b A G 7: 75,206,206 F112S probably damaging Het
Sycp1 G A 3: 102,840,980 T832I probably benign Het
Tm9sf2 A T 14: 122,145,113 E179V probably damaging Het
Tmem209 A G 6: 30,508,456 I66T probably damaging Het
Tspan10 T C 11: 120,444,723 W220R probably damaging Het
Ttc39b G C 4: 83,246,276 N266K probably damaging Het
Uri1 A T 7: 37,965,339 D309E probably benign Het
Zfhx3 C T 8: 108,800,641 R1057W probably damaging Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7084:Mast3 UTSW 8 70779473 missense probably benign 0.14
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8415:Mast3 UTSW 8 70781222 missense probably damaging 1.00
R8457:Mast3 UTSW 8 70780441 missense probably benign 0.39
R8530:Mast3 UTSW 8 70788233 missense possibly damaging 0.92
R8891:Mast3 UTSW 8 70781157 missense probably damaging 1.00
R8930:Mast3 UTSW 8 70781733 splice site probably benign
R9002:Mast3 UTSW 8 70781260 missense probably damaging 1.00
R9085:Mast3 UTSW 8 70796717 missense unknown
R9087:Mast3 UTSW 8 70789686 missense possibly damaging 0.93
R9148:Mast3 UTSW 8 70780447 missense probably damaging 0.98
R9364:Mast3 UTSW 8 70786182 missense probably damaging 1.00
R9779:Mast3 UTSW 8 70785483 missense probably damaging 1.00
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGATGGAACTCTGCCCAC -3'
(R):5'- TTGGACTTGGAGTAATGGCTAC -3'

Sequencing Primer
(F):5'- GATGGAACTCTGCCCACAGCTAG -3'
(R):5'- CCCTTCTTGTGTGCAGGGC -3'
Posted On 2018-10-18