Mutagenetix > Incidental Mutation

Incidental Mutation 'R5333:Mast3'

423354

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

042915-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5333 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70783501 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 761 (L761P)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: L761P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: L761P

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: L745P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.5%
20x: 95.9%

Validation Efficiency

97% (56/58)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930430A15Rik	A	T	2: 111,194,337	Y61N	possibly damaging	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abca14	T	A	7: 120,289,546	Y1238*	probably null	Het
Abcb5	A	T	12: 118,867,942	V1225D	probably damaging	Het
Arhgef15	A	G	11: 68,947,196		probably benign	Het
As3mt	A	G	19: 46,708,196	R58G	probably null	Het
Asap1	T	G	15: 64,127,414	N525T	possibly damaging	Het
Bhmt2	A	G	13: 93,671,430	V50A	probably benign	Het
Ccdc180	A	T	4: 45,890,935	I36F	possibly damaging	Het
Cd209c	A	G	8: 3,944,976	S63P	probably damaging	Het
Cdc37	T	C	9: 21,143,161	E56G	possibly damaging	Het
Cdkal1	T	C	13: 29,326,152	Y541C	probably benign	Het
Cenph	G	T	13: 100,761,772	H208N	probably benign	Het
Cfap65	A	T	1: 74,903,175	L1740Q	probably benign	Het
Cfap74	A	G	4: 155,436,740	D623G	probably damaging	Het
Ckap4	C	A	10: 84,527,610	V530L	probably damaging	Het
Cldn13	A	T	5: 134,915,015	N105K	probably benign	Het
Ddn	T	C	15: 98,805,356	D685G	possibly damaging	Het
Fam155a	T	A	8: 9,770,762	Q86L	possibly damaging	Het
Fdxr	T	C	11: 115,272,258	I70V	probably benign	Het
Fn1	A	T	1: 71,624,180	Y1050N	probably damaging	Het
Impad1	A	C	4: 4,767,963	V271G	possibly damaging	Het
Iqcf3	A	G	9: 106,553,661	I96T	possibly damaging	Het
Itgax	A	G	7: 128,142,283	Y822C	probably damaging	Het
Katnb1	A	T	8: 95,095,606	I286L	possibly damaging	Het
Lrp2	A	C	2: 69,525,228	I424R	probably benign	Het
Lrpprc	C	A	17: 84,790,393	A41S	probably benign	Het
Mmp1b	T	C	9: 7,384,897	I251V	possibly damaging	Het
Mpp4	C	A	1: 59,157,441	R44L	probably benign	Het
Nkain3	T	A	4: 20,484,889	M63L	probably benign	Het
Nup88	A	C	11: 70,945,016		probably benign	Het
Obscn	A	T	11: 59,062,692	C3837S	probably damaging	Het
Ogdh	T	G	11: 6,352,126	L850V	probably damaging	Het
Olfr1131	A	G	2: 87,629,114	Y217C	probably damaging	Het
Olfr1293-ps	A	G	2: 111,527,703	I148V	probably benign	Het
Panx2	T	C	15: 89,068,539	I411T	possibly damaging	Het
Papss1	T	A	3: 131,643,044	M585K	probably damaging	Het
Pcbp2	T	G	15: 102,486,021	L180R	possibly damaging	Het
Pcdha7	A	T	18: 36,974,566	T215S	probably benign	Het
Pcdhga4	C	T	18: 37,685,424	R9C	probably benign	Het
Plin4	A	G	17: 56,104,970	V687A	probably benign	Het
Psma6	A	G	12: 55,407,428		probably benign	Het
Rcn1	A	T	2: 105,389,126	S241T	probably benign	Het
Scgb2b18	A	T	7: 33,173,275	L35H	probably damaging	Het
Slc11a1	A	C	1: 74,384,145	D385A	probably damaging	Het
Stk31	T	A	6: 49,469,152	C930S	probably benign	Het
Syt10	T	A	15: 89,841,729	Q14L	probably benign	Het
Tnxb	T	G	17: 34,690,231	W1578G	probably damaging	Het
Triml1	C	T	8: 43,130,290	A425T	possibly damaging	Het
Vil1	G	A	1: 74,432,390	V777I	probably benign	Het
Vmn1r175	T	C	7: 23,808,579	I208V	possibly damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCCAAGTTCCACAGTGTTATG -3'
(R):5'- CCGGTGGCAATTTTCCTGAG -3'

Sequencing Primer
(F):5'- TCCACAGTGTTATGGAGCAC -3'
(R):5'- GGCAATTTTCCTGAGTCCGTCTG -3'

Posted On

2016-08-04