Incidental Mutation 'R7084:Mast3'
ID549757
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Namemicrotubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7084 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70778117-70805054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70779473 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1287 (I1287V)
Ref Sequence ENSEMBL: ENSMUSP00000148686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]
Predicted Effect probably benign
Transcript: ENSMUST00000034296
SMART Domains Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
SH3 7 79 4e-7 SMART
RhoGAP 122 286 2.36e-18 SMART
low complexity region 291 311 N/A INTRINSIC
SH2 322 405 4.51e-26 SMART
Pfam:PI3K_P85_iSH2 422 590 1.7e-64 PFAM
SH2 614 696 9.96e-28 SMART
low complexity region 713 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154685
SMART Domains Protein: ENSMUSP00000121463
Gene: ENSMUSG00000031834

DomainStartEndE-ValueType
PDB:2XS6|A 43 84 3e-11 PDB
SCOP:d1pbwa_ 47 79 6e-9 SMART
Blast:RhoGAP 58 84 4e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000166004
AA Change: I1303V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: I1303V

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211948
AA Change: I1287V

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Meta Mutation Damage Score 0.0706 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (81/82)
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110070M22Rik A T 13: 119,488,185 D8E unknown Het
4931440F15Rik G T 11: 29,825,009 H149Q probably damaging Het
Abca5 T A 11: 110,301,545 I714L probably benign Het
Abce1 T A 8: 79,699,414 S245C probably benign Het
Abcg1 T A 17: 31,106,131 D310E probably benign Het
Adhfe1 T A 1: 9,566,805 I394N probably benign Het
Apob A T 12: 8,009,591 D2691V probably benign Het
Arhgap18 A G 10: 26,872,738 T340A possibly damaging Het
Arsb A T 13: 93,940,616 Q497L probably benign Het
Asic5 T C 3: 82,012,011 I354T probably benign Het
Atp6v0a1 T C 11: 101,034,042 C318R probably damaging Het
Cftr T C 6: 18,226,138 Y362H probably benign Het
Crip3 T C 17: 46,430,790 Y113H probably benign Het
Dcaf4 AT A 12: 83,537,797 probably null Het
Dock10 T A 1: 80,503,856 I475F Het
Dqx1 T A 6: 83,066,455 Y674N probably damaging Het
Dync2h1 G T 9: 7,113,214 Q2437K possibly damaging Het
Ednra A T 8: 77,665,105 C385* probably null Het
Fam216a G A 5: 122,369,560 T68I probably benign Het
Fbxw22 A G 9: 109,404,223 L14P probably damaging Het
Fkbp10 A G 11: 100,421,303 I230V possibly damaging Het
Ggn C A 7: 29,172,998 A637E probably damaging Het
Gm156 C A 6: 129,766,710 A204S possibly damaging Het
Hcrtr2 T C 9: 76,230,660 D391G probably benign Het
Heatr5b A T 17: 78,810,563 V817D possibly damaging Het
Il1f10 G A 2: 24,293,670 W120* probably null Het
Irf5 C A 6: 29,535,877 R297S probably damaging Het
Jak2 A G 19: 29,286,398 T438A possibly damaging Het
Jsrp1 T C 10: 80,808,576 D332G possibly damaging Het
Kank4 A T 4: 98,771,345 V832D probably damaging Het
Kcnip3 C T 2: 127,510,936 S25N probably benign Het
Klk1b16 C T 7: 44,139,486 H48Y probably benign Het
Krtap5-4 G A 7: 142,303,872 C93Y unknown Het
Lacc1 T A 14: 77,029,656 Q389L probably benign Het
Lin9 C A 1: 180,688,096 T477K probably benign Het
Lpar2 A T 8: 69,823,606 N15I probably damaging Het
Ltbp2 C A 12: 84,868,685 C200F probably damaging Het
Mall G T 2: 127,708,873 H122Q probably benign Het
Mindy4 T C 6: 55,278,235 I566T probably benign Het
Mme T C 3: 63,328,217 Y195H probably damaging Het
Mpzl1 T C 1: 165,604,698 T173A probably benign Het
Mri1 G T 8: 84,251,079 T209N Het
Myo1e A G 9: 70,337,801 I394V probably damaging Het
Nat14 T C 7: 4,924,330 V167A possibly damaging Het
Nfasc A G 1: 132,570,509 Y1212H unknown Het
Nsun7 T A 5: 66,295,421 L493Q probably damaging Het
Obsl1 A T 1: 75,487,750 S1637R probably benign Het
Ocstamp A T 2: 165,398,037 Y76* probably null Het
Olfr1443 A C 19: 12,680,834 H242P probably damaging Het
Olfr769 T A 10: 129,111,547 K293* probably null Het
Olfr917 G A 9: 38,665,269 R192C probably benign Het
Otog T A 7: 46,298,566 C145* probably null Het
Padi6 T A 4: 140,741,558 K5* probably null Het
Pcdha5 T A 18: 36,961,562 S375T probably benign Het
Pde10a C T 17: 8,941,162 P140S probably benign Het
Pgbd1 C G 13: 21,423,130 C298S possibly damaging Het
Plch2 C T 4: 154,986,991 G977D probably benign Het
Pou2f3 T C 9: 43,128,893 T367A probably damaging Het
Ppm1j T A 3: 104,784,960 Y352N probably damaging Het
Prkag2 T C 5: 25,021,969 T97A probably benign Het
Rpl36a-ps1 T A 14: 98,994,224 Y26F probably benign Het
Sctr A T 1: 120,063,271 N445Y possibly damaging Het
Serping1 C T 2: 84,773,491 V69I probably benign Het
Slc8a2 T A 7: 16,145,038 L483Q probably benign Het
Spag17 T C 3: 99,939,270 F37L probably benign Het
Srrm2 T A 17: 23,820,316 M1978K probably damaging Het
Tcp11 T C 17: 28,067,021 Q540R probably benign Het
Thnsl1 G T 2: 21,212,330 R298S possibly damaging Het
Tigd5 T A 15: 75,910,381 Y197* probably null Het
Tmprss11g A T 5: 86,492,200 L203Q probably damaging Het
Trim35 T A 14: 66,308,822 V346E probably damaging Het
Ttn T C 2: 76,768,364 I19402V possibly damaging Het
Ttn C T 2: 76,919,345 E3787K probably benign Het
Tut1 G A 19: 8,965,414 V622I probably benign Het
Vmn1r2 A G 4: 3,172,134 I18V probably benign Het
Zbbx T C 3: 75,139,546 N22S possibly damaging Het
Zfp169 A C 13: 48,498,863 M26R probably benign Het
Zfp180 T A 7: 24,105,261 H368Q probably damaging Het
Zfp638 T A 6: 83,953,126 S770T possibly damaging Het
Znrf1 T C 8: 111,537,142 M1T probably null Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 70780683 splice site probably benign
IGL01411:Mast3 APN 8 70779583 missense possibly damaging 0.50
IGL01475:Mast3 APN 8 70779530 missense probably damaging 1.00
IGL01886:Mast3 APN 8 70782139 missense possibly damaging 0.94
IGL02104:Mast3 APN 8 70787906 missense possibly damaging 0.78
IGL02236:Mast3 APN 8 70789244 missense probably benign 0.36
IGL02437:Mast3 APN 8 70780558 missense possibly damaging 0.79
IGL02704:Mast3 APN 8 70786875 missense probably damaging 1.00
IGL03155:Mast3 APN 8 70789217 missense probably damaging 1.00
IGL03366:Mast3 APN 8 70781563 nonsense probably null
gravy UTSW 8 70786635 missense probably damaging 1.00
stuffing UTSW 8 70784797 frame shift probably null
turkey UTSW 8 70785482 missense probably damaging 1.00
BB010:Mast3 UTSW 8 70786635 missense probably damaging 1.00
BB020:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R0037:Mast3 UTSW 8 70783699 critical splice donor site probably null
R0280:Mast3 UTSW 8 70783795 missense probably damaging 1.00
R0280:Mast3 UTSW 8 70787920 missense possibly damaging 0.65
R0731:Mast3 UTSW 8 70781321 missense probably damaging 1.00
R1101:Mast3 UTSW 8 70786663 missense probably damaging 1.00
R1177:Mast3 UTSW 8 70780324 missense probably damaging 1.00
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1208:Mast3 UTSW 8 70788272 splice site probably null
R1333:Mast3 UTSW 8 70781294 missense probably damaging 1.00
R1543:Mast3 UTSW 8 70792311 missense possibly damaging 0.93
R1544:Mast3 UTSW 8 70786172 missense probably damaging 1.00
R1738:Mast3 UTSW 8 70784556 missense probably benign 0.38
R1842:Mast3 UTSW 8 70780393 missense possibly damaging 0.91
R1936:Mast3 UTSW 8 70784800 missense probably damaging 1.00
R2015:Mast3 UTSW 8 70787363 missense probably benign 0.00
R2219:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R2220:Mast3 UTSW 8 70780963 missense probably damaging 0.99
R3711:Mast3 UTSW 8 70779607 missense probably benign 0.13
R3919:Mast3 UTSW 8 70779422 missense probably benign 0.02
R4027:Mast3 UTSW 8 70787908 missense probably damaging 1.00
R4060:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4061:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4062:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4063:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R4588:Mast3 UTSW 8 70780607 nonsense probably null
R4672:Mast3 UTSW 8 70784797 frame shift probably null
R4770:Mast3 UTSW 8 70786220 missense probably damaging 1.00
R4822:Mast3 UTSW 8 70780366 missense probably damaging 1.00
R4830:Mast3 UTSW 8 70788915 missense possibly damaging 0.87
R5196:Mast3 UTSW 8 70788245 missense probably damaging 1.00
R5333:Mast3 UTSW 8 70783501 missense probably benign 0.03
R5428:Mast3 UTSW 8 70784733 missense possibly damaging 0.95
R5656:Mast3 UTSW 8 70786221 missense probably damaging 1.00
R5920:Mast3 UTSW 8 70787933 missense probably benign 0.00
R6177:Mast3 UTSW 8 70790018 missense probably damaging 1.00
R6186:Mast3 UTSW 8 70785483 missense probably damaging 1.00
R6407:Mast3 UTSW 8 70782128 missense probably benign 0.02
R6614:Mast3 UTSW 8 70781966 missense possibly damaging 0.95
R6804:Mast3 UTSW 8 70786732 missense probably benign 0.29
R6873:Mast3 UTSW 8 70786592 nonsense probably null
R6930:Mast3 UTSW 8 70799471 nonsense probably null
R6948:Mast3 UTSW 8 70785482 missense probably damaging 1.00
R7253:Mast3 UTSW 8 70789682 critical splice donor site probably null
R7316:Mast3 UTSW 8 70779788 missense probably damaging 1.00
R7357:Mast3 UTSW 8 70784859 missense probably damaging 1.00
R7405:Mast3 UTSW 8 70786171 missense probably damaging 1.00
R7429:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7430:Mast3 UTSW 8 70780303 missense probably damaging 1.00
R7521:Mast3 UTSW 8 70788768 missense probably benign 0.16
R7576:Mast3 UTSW 8 70781194 missense probably damaging 1.00
R7933:Mast3 UTSW 8 70786635 missense probably damaging 1.00
R7998:Mast3 UTSW 8 70783570 missense probably benign
R8021:Mast3 UTSW 8 70788252 missense probably benign 0.02
R8204:Mast3 UTSW 8 70788281 missense probably benign 0.00
R8327:Mast3 UTSW 8 70779418 missense probably damaging 1.00
R8357:Mast3 UTSW 8 70780441 missense probably benign 0.39
Z1177:Mast3 UTSW 8 70789038 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ATTTACAAGTCACTGGCACCC -3'
(R):5'- AAGCAGTATCCCTCCATCTCCG -3'

Sequencing Primer
(F):5'- GTCACTGGCACCCCCATC -3'
(R):5'- TCTCCTAGGCTGCGTAGG -3'
Posted On2019-05-15