Mutagenetix > Incidental Mutation

Incidental Mutation 'R1842:Mast3'

205824

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

039867-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1842 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 70780393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1108 (F1108L)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034296] [ENSMUST00000166004] [ENSMUST00000211948]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000034296

SMART Domains

Protein: ENSMUSP00000034296
Gene: ENSMUSG00000031834

Domain	Start	End	E-Value	Type
SH3	7	79	4e-7	SMART
RhoGAP	122	286	2.36e-18	SMART
low complexity region	291	311	N/A	INTRINSIC
SH2	322	405	4.51e-26	SMART
Pfam:PI3K_P85_iSH2	422	590	1.7e-64	PFAM
SH2	614	696	9.96e-28	SMART
low complexity region	713	718	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142370

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166004
AA Change: F1108L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: F1108L

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191396

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: F1092L

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)

Predicted Effect

unknown
Transcript: ENSMUST00000212140
AA Change: F343L

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Coding Region Coverage

1x: 97.4%
3x: 96.7%
10x: 94.8%
20x: 90.8%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,506	Y82C	probably damaging	Het
Abca6	G	T	11: 110,197,039	N1087K	probably benign	Het
Abcc3	G	A	11: 94,359,612	T921I	probably benign	Het
Abr	T	A	11: 76,508,986	I4F	probably damaging	Het
Adcy10	T	A	1: 165,503,243	V25D	probably damaging	Het
Ahnak	T	A	19: 9,005,867	M1505K	probably damaging	Het
Alms1-ps2	T	C	6: 85,796,249		noncoding transcript	Het
Apob	C	G	12: 8,011,559	T3347S	probably damaging	Het
Arhgap27	C	A	11: 103,339,996	G11W	probably damaging	Het
Armc4	A	T	18: 7,223,551	D497E	probably benign	Het
Ccdc110	A	T	8: 45,940,568	I106F	probably damaging	Het
Ccdc28b	T	A	4: 129,621,013	D101V	probably damaging	Het
Ccdc30	T	C	4: 119,331,127	E566G	probably benign	Het
Cenpm	T	C	15: 82,239,364	S111G	probably benign	Het
Cep55	A	G	19: 38,057,900	I34V	probably benign	Het
Dcdc2a	T	C	13: 25,107,602	L190S	probably damaging	Het
Dhh	T	C	15: 98,894,560		probably null	Het
Dst	A	G	1: 34,164,119	N703S	probably null	Het
E030025P04Rik	G	A	11: 109,139,570	L164F	unknown	Het
Efcab5	A	G	11: 77,134,875	V538A	probably benign	Het
Egflam	A	G	15: 7,303,941	S177P	probably benign	Het
Ehbp1l1	A	T	19: 5,725,930	C31S	probably damaging	Het
Eif2d	C	A	1: 131,171,060	Q532K	probably damaging	Het
Elf3	T	C	1: 135,256,793	D175G	possibly damaging	Het
F5	T	C	1: 164,184,560	V449A	probably damaging	Het
Fam110a	A	T	2: 151,970,034	I272N	probably damaging	Het
Fbxo34	A	G	14: 47,531,007	D608G	probably damaging	Het
Flrt2	T	C	12: 95,779,284	L132P	probably damaging	Het
Frg2f1	A	T	4: 119,531,080	V74D	possibly damaging	Het
Gad1	G	T	2: 70,574,253	E162D	probably benign	Het
Glb1l	A	G	1: 75,200,460	V444A	probably damaging	Het
Gm10770	G	A	2: 150,179,156	T147I	probably damaging	Het
Gm43302	T	C	5: 105,277,736	I276V	probably benign	Het
Greb1	T	C	12: 16,696,243	H1314R	probably damaging	Het
Hapln2	A	G	3: 88,024,001	V69A	probably damaging	Het
Hcn1	T	C	13: 117,976,008	I836T	probably damaging	Het
Hspa5	A	G	2: 34,775,803	D553G	probably damaging	Het
Iqgap1	A	T	7: 80,760,883	I194N	probably damaging	Het
Kansl3	A	G	1: 36,351,744	V304A	probably damaging	Het
Kdm5d	C	T	Y: 927,798	S716L	probably damaging	Het
Klra6	T	C	6: 130,022,610	T132A	probably benign	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrp1	A	G	10: 127,573,468	I1594T	possibly damaging	Het
Lrp2bp	A	G	8: 46,011,115	D15G	probably benign	Het
Map4k1	T	C	7: 28,987,163	L170P	probably damaging	Het
Mettl5	G	T	2: 69,885,342	L6I	unknown	Het
Mfsd14a	A	T	3: 116,632,408	F447I	possibly damaging	Het
Mrc2	A	G	11: 105,337,720	I642V	probably damaging	Het
Necap1	A	G	6: 122,874,588	Y7C	probably damaging	Het
Nsd1	G	A	13: 55,246,445	E723K	probably damaging	Het
Nsun3	A	T	16: 62,776,392	L121H	probably damaging	Het
Nsun6	A	T	2: 15,009,477	M284K	probably damaging	Het
Nutf2	T	C	8: 105,876,610		probably null	Het
Olfr1166	A	T	2: 88,124,127	M286K	probably damaging	Het
Olfr352	A	T	2: 36,869,589	N8Y	probably damaging	Het
Pacs1	T	C	19: 5,155,884	E288G	probably damaging	Het
Peg10	A	T	6: 4,756,381		probably benign	Het
Rab38	G	A	7: 88,450,522	E82K	possibly damaging	Het
Rgsl1	T	A	1: 153,799,797	E206V	probably damaging	Het
Scube3	G	A	17: 28,165,089	V521I	probably damaging	Het
Sgpp1	C	T	12: 75,716,208	V400M	probably damaging	Het
Slc18b1	T	C	10: 23,805,993	S152P	possibly damaging	Het
Slit1	A	T	19: 41,721,038		probably null	Het
Spta1	A	G	1: 174,195,947	K640R	probably benign	Het
Svil	A	G	18: 5,062,373	T898A	probably damaging	Het
Tex45	T	A	8: 3,483,668	F295L	possibly damaging	Het
Timm44	A	G	8: 4,260,510		probably null	Het
Tomm40	A	G	7: 19,713,725	S127P	probably benign	Het
Vmn2r23	T	A	6: 123,729,690	V493D	possibly damaging	Het
Yeats2	T	C	16: 20,171,238	V288A	probably damaging	Het
Zfhx4	C	T	3: 5,401,498	R2239W	probably damaging	Het
Zscan2	A	C	7: 80,875,553	K341Q	probably damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TATACATTCATATCCACAGGCAGAG -3'
(R):5'- AGGTGACTGGTGTTCCTTCC -3'

Sequencing Primer
(F):5'- TCCACAGGCAGAGTTTCATAAAG -3'
(R):5'- ACTGGTGTTCCTTCCGCAGAG -3'

Posted On

2014-06-23