Mutagenetix > Incidental Mutation

Incidental Mutation 'R2353:Ap3b2'

246255

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

Naptb, beta3B

MMRRC Submission

040335-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.105) question?

Stock #

R2353 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

81110147-81143673 bp(-) (GRCm39)

Type of Mutation

unclassified

DNA Base Change (assembly)

C to T at 81123598 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000146497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

probably benign
Transcript: ENSMUST00000082090

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125634

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 31 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aadacl4	G	T	4: 144,349,779 (GRCm39)	E345D	probably damaging	Het
Adam7	T	A	14: 68,742,537 (GRCm39)	Q692L	probably benign	Het
Ankk1	A	C	9: 49,329,990 (GRCm39)	C322G	probably benign	Het
Apeh	T	C	9: 107,963,491 (GRCm39)	D577G	possibly damaging	Het
Aspm	T	A	1: 139,405,435 (GRCm39)	W1441R	probably damaging	Het
B4galt3	C	A	1: 171,101,613 (GRCm39)	H196N	probably damaging	Het
Cd163	G	T	6: 124,296,115 (GRCm39)	E820*	probably null	Het
Cd38	T	A	5: 44,065,353 (GRCm39)		probably null	Het
Cdh15	G	A	8: 123,588,763 (GRCm39)	R279Q	probably damaging	Het
Enpp1	C	A	10: 24,527,239 (GRCm39)	Q649H	probably benign	Het
Garnl3	T	A	2: 32,954,046 (GRCm39)	R86S	probably damaging	Het
Gbe1	A	G	16: 70,233,909 (GRCm39)		probably null	Het
Gm5117	A	G	8: 32,229,223 (GRCm39)		noncoding transcript	Het
Hip1	A	T	5: 135,441,566 (GRCm39)	V568E	probably damaging	Het
Hspa14	G	A	2: 3,512,213 (GRCm39)		probably null	Het
Lrrc4	A	G	6: 28,831,451 (GRCm39)	F55L	probably benign	Het
Med31	T	A	11: 72,104,966 (GRCm39)	N35I	probably damaging	Het
Msi1	C	A	5: 115,574,568 (GRCm39)		probably benign	Het
Or1e34	T	C	11: 73,778,660 (GRCm39)	I179M	probably benign	Het
Or4b1	A	T	2: 89,980,062 (GRCm39)	L96Q	probably damaging	Het
Parl	T	C	16: 20,105,790 (GRCm39)	T211A	probably benign	Het
Ppwd1	T	C	13: 104,350,090 (GRCm39)	I432V	probably benign	Het
Scn10a	T	A	9: 119,467,753 (GRCm39)	I796F	probably damaging	Het
Semp2l2a	T	A	8: 13,886,951 (GRCm39)	E380V	probably damaging	Het
Sh3rf3	A	G	10: 58,842,895 (GRCm39)	D287G	probably damaging	Het
Sin3b	T	C	8: 73,450,780 (GRCm39)		probably null	Het
Ubr4	T	C	4: 139,160,984 (GRCm39)	I2493T	possibly damaging	Het
Uts2	T	A	4: 151,084,593 (GRCm39)		probably null	Het
Zfp109	T	C	7: 23,928,806 (GRCm39)	D201G	probably benign	Het
Zfp407	A	G	18: 84,578,005 (GRCm39)	F1036S	probably damaging	Het
Znrf3	T	C	11: 5,231,170 (GRCm39)	E685G	probably damaging	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81,121,697 (GRCm39)	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81,126,687 (GRCm39)	splice site	probably benign
IGL01876:Ap3b2	APN	7	81,123,602 (GRCm39)	splice site	probably null
IGL02132:Ap3b2	APN	7	81,110,746 (GRCm39)	missense	unknown
IGL02227:Ap3b2	APN	7	81,123,152 (GRCm39)	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81,115,446 (GRCm39)	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81,115,941 (GRCm39)	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81,115,941 (GRCm39)	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81,122,828 (GRCm39)	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81,113,429 (GRCm39)	splice site	probably null
R0568:Ap3b2	UTSW	7	81,114,377 (GRCm39)	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81,113,659 (GRCm39)	missense	unknown
R1121:Ap3b2	UTSW	7	81,113,943 (GRCm39)	missense	unknown
R1160:Ap3b2	UTSW	7	81,115,917 (GRCm39)	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81,113,438 (GRCm39)	nonsense	probably null
R1542:Ap3b2	UTSW	7	81,127,825 (GRCm39)	splice site	probably null
R1652:Ap3b2	UTSW	7	81,123,147 (GRCm39)	missense	probably damaging	1.00
R1741:Ap3b2	UTSW	7	81,117,347 (GRCm39)	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81,113,898 (GRCm39)	missense	unknown
R2065:Ap3b2	UTSW	7	81,113,522 (GRCm39)	missense	unknown
R2354:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81,126,943 (GRCm39)	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81,123,598 (GRCm39)	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81,127,765 (GRCm39)	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81,126,884 (GRCm39)	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81,121,680 (GRCm39)	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81,121,680 (GRCm39)	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81,127,678 (GRCm39)	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81,126,517 (GRCm39)	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81,126,500 (GRCm39)	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81,143,340 (GRCm39)	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81,123,210 (GRCm39)	nonsense	probably null
R6901:Ap3b2	UTSW	7	81,134,660 (GRCm39)	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81,127,741 (GRCm39)	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81,110,757 (GRCm39)	missense	unknown
R7317:Ap3b2	UTSW	7	81,110,776 (GRCm39)	missense	unknown
R7501:Ap3b2	UTSW	7	81,123,194 (GRCm39)	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81,115,894 (GRCm39)	splice site	probably null
R7643:Ap3b2	UTSW	7	81,126,820 (GRCm39)	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81,126,530 (GRCm39)	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81,113,530 (GRCm39)	missense	unknown
R8273:Ap3b2	UTSW	7	81,112,990 (GRCm39)	missense	unknown
R8325:Ap3b2	UTSW	7	81,134,237 (GRCm39)	splice site	probably null
R8355:Ap3b2	UTSW	7	81,122,851 (GRCm39)	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81,122,783 (GRCm39)	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81,126,901 (GRCm39)	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81,126,931 (GRCm39)	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81,117,192 (GRCm39)	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81,113,546 (GRCm39)	missense	unknown
R9304:Ap3b2	UTSW	7	81,113,019 (GRCm39)	missense	unknown
R9321:Ap3b2	UTSW	7	81,114,252 (GRCm39)	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81,127,757 (GRCm39)	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81,123,651 (GRCm39)	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81,126,092 (GRCm39)	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81,112,988 (GRCm39)	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81,113,512 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCCAGAGATTAAGTCTTGGGG -3'
(R):5'- TCTAAGCATGTGCAGAGCTG -3'

Sequencing Primer
(F):5'- TGGGGAACTATGATGTCTCCAAACC -3'
(R):5'- AGAGCTGCCCTGAGTATTGC -3'

Posted On

2014-10-30