Incidental Mutation 'R4233:Plxnd1'
List |< first << previous [record 36 of 50] next >> last >|
ID320958
Institutional Source Beutler Lab
Gene Symbol Plxnd1
Ensembl Gene ENSMUSG00000030123
Gene Nameplexin D1
Synonymsb2b553Clo, 6230425C21Rik, b2b1863Clo
MMRRC Submission 041642-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4233 (G1)
Quality Score223
Status Validated
Chromosome6
Chromosomal Location115954811-115995005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115965953 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 1257 (N1257D)
Ref Sequence ENSEMBL: ENSMUSP00000015511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015511]
Predicted Effect probably benign
Transcript: ENSMUST00000015511
AA Change: N1257D

PolyPhen 2 Score 0.301 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000015511
Gene: ENSMUSG00000030123
AA Change: N1257D

DomainStartEndE-ValueType
signal peptide 1 48 N/A INTRINSIC
Sema 61 531 6.52e-90 SMART
PSI 550 603 6.06e-12 SMART
PSI 703 755 1.06e-2 SMART
Blast:PSI 850 891 9e-20 BLAST
IPT 892 981 4.43e-20 SMART
IPT 982 1068 6.61e-19 SMART
IPT 1070 1149 6.13e-14 SMART
transmembrane domain 1271 1293 N/A INTRINSIC
Pfam:Plexin_cytopl 1345 1888 5e-238 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131590
SMART Domains Protein: ENSMUSP00000115650
Gene: ENSMUSG00000030123

DomainStartEndE-ValueType
Blast:PSI 2 34 1e-13 BLAST
IPT 35 124 4.43e-20 SMART
Blast:IPT 125 177 3e-30 BLAST
Pfam:TIG 180 233 4.6e-6 PFAM
Meta Mutation Damage Score 0.1194 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality, thin-walled atria, and vascular abnormalities including abnormal branchial arch artery development, cardiac outflow tract abnormalities, and reduced vascular smooth muscle around some vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A T 5: 138,564,192 Y96N probably damaging Het
Abca15 C T 7: 120,402,979 Q1572* probably null Het
Ajuba T C 14: 54,569,526 R490G probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Aph1c A G 9: 66,833,321 F41S probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Arhgef40 T C 14: 51,990,171 V458A possibly damaging Het
Atg14 T C 14: 47,551,345 K184E probably benign Het
Casp8 T C 1: 58,844,770 V432A probably damaging Het
Ccar2 T C 14: 70,151,091 T169A possibly damaging Het
Cfap58 G A 19: 47,975,555 V541M possibly damaging Het
Coro2b T C 9: 62,426,185 E376G possibly damaging Het
Dnah11 T C 12: 117,916,791 T3865A probably damaging Het
Dync2h1 T C 9: 7,134,360 E1549G probably benign Het
Ercc6l2 T C 13: 63,872,168 probably benign Het
Fam160b2 A C 14: 70,586,878 V473G probably damaging Het
Fbxo32 G T 15: 58,192,333 T135K possibly damaging Het
Fras1 A T 5: 96,714,376 I2205F possibly damaging Het
Gm12034 A G 11: 20,446,785 noncoding transcript Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Gm5108 C A 5: 67,975,153 T55K unknown Het
Gpa33 A T 1: 166,146,771 D59V probably damaging Het
Gpn2 T A 4: 133,584,705 Y83N probably damaging Het
Gzf1 C T 2: 148,686,533 P460S possibly damaging Het
Ifi203 A T 1: 173,936,533 S124R possibly damaging Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ldlrap1 T A 4: 134,757,338 probably null Het
Madd T C 2: 91,178,236 E107G probably benign Het
Med12l T G 3: 59,257,223 probably null Het
Nxpe4 A T 9: 48,398,837 T467S probably damaging Het
Olfr658 A G 7: 104,644,988 V126A probably benign Het
Olfr849 T A 9: 19,441,590 L226I probably damaging Het
Pam A T 1: 97,864,394 V434D possibly damaging Het
Prkdc C T 16: 15,835,919 A3870V probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Ryr2 T C 13: 11,750,725 D1375G probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc13a2 A G 11: 78,403,535 probably benign Het
Slc7a13 T C 4: 19,819,070 F90S probably damaging Het
Spc24 T C 9: 21,756,202 probably null Het
Stard13 A G 5: 151,062,699 S331P probably benign Het
Sult2a8 T A 7: 14,413,683 I228L probably benign Het
Tas2r140 A T 6: 133,054,952 V281D probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tshz1 C A 18: 84,016,195 E29D probably benign Het
Zfp599 T A 9: 22,249,745 K375* probably null Het
Other mutations in Plxnd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Plxnd1 APN 6 115967972 missense possibly damaging 0.51
IGL01099:Plxnd1 APN 6 115969945 missense probably benign
IGL01323:Plxnd1 APN 6 115966799 missense possibly damaging 0.81
IGL01382:Plxnd1 APN 6 115960527 missense probably damaging 1.00
IGL01786:Plxnd1 APN 6 115959935 missense probably damaging 1.00
IGL02244:Plxnd1 APN 6 115978257 missense probably benign 0.39
IGL02272:Plxnd1 APN 6 115993628 missense probably damaging 1.00
IGL02293:Plxnd1 APN 6 115963913 missense probably damaging 1.00
IGL02465:Plxnd1 APN 6 115955742 makesense probably null
IGL02873:Plxnd1 APN 6 115959976 missense probably damaging 1.00
IGL03209:Plxnd1 APN 6 115962357 missense probably damaging 1.00
murmer UTSW 6 115968793 missense probably benign 0.00
mutter UTSW 6 115968044 missense probably benign 0.27
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0238:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0239:Plxnd1 UTSW 6 115968793 missense probably benign 0.00
R0357:Plxnd1 UTSW 6 115969460 missense probably benign 0.00
R0646:Plxnd1 UTSW 6 115958699 splice site probably benign
R0648:Plxnd1 UTSW 6 115994001 missense possibly damaging 0.86
R0718:Plxnd1 UTSW 6 115966638 missense possibly damaging 0.68
R1116:Plxnd1 UTSW 6 115967005 splice site probably null
R1292:Plxnd1 UTSW 6 115962683 unclassified probably benign
R1715:Plxnd1 UTSW 6 115968681 missense probably benign 0.02
R1760:Plxnd1 UTSW 6 115967779 missense possibly damaging 0.95
R1799:Plxnd1 UTSW 6 115994057 missense probably damaging 1.00
R1817:Plxnd1 UTSW 6 115980601 missense possibly damaging 0.83
R1848:Plxnd1 UTSW 6 115966546 missense probably damaging 1.00
R1851:Plxnd1 UTSW 6 115963914 missense probably damaging 1.00
R1864:Plxnd1 UTSW 6 115969441 splice site probably null
R1865:Plxnd1 UTSW 6 115969441 splice site probably null
R1875:Plxnd1 UTSW 6 115978084 splice site probably null
R1899:Plxnd1 UTSW 6 115969363 missense probably benign
R1913:Plxnd1 UTSW 6 115978017 missense possibly damaging 0.50
R1970:Plxnd1 UTSW 6 115962517 missense probably damaging 1.00
R2007:Plxnd1 UTSW 6 115967255 missense probably damaging 1.00
R2134:Plxnd1 UTSW 6 115957548 missense probably damaging 1.00
R2202:Plxnd1 UTSW 6 115962764 missense probably benign 0.45
R2230:Plxnd1 UTSW 6 115964144 missense probably damaging 1.00
R2267:Plxnd1 UTSW 6 115962743 missense probably benign 0.29
R2427:Plxnd1 UTSW 6 115967748 critical splice donor site probably null
R4108:Plxnd1 UTSW 6 115959315 missense probably damaging 1.00
R4280:Plxnd1 UTSW 6 115956094 splice site probably benign
R4280:Plxnd1 UTSW 6 115956095 splice site probably null
R4346:Plxnd1 UTSW 6 115977980 missense probably benign 0.16
R4439:Plxnd1 UTSW 6 115993976 missense probably damaging 0.99
R4572:Plxnd1 UTSW 6 115955756 missense probably damaging 1.00
R4576:Plxnd1 UTSW 6 115968044 missense probably benign 0.27
R4599:Plxnd1 UTSW 6 115994276 missense probably damaging 1.00
R4614:Plxnd1 UTSW 6 115972525 missense possibly damaging 0.83
R4700:Plxnd1 UTSW 6 115958615 missense probably damaging 1.00
R4705:Plxnd1 UTSW 6 115958620 missense probably damaging 1.00
R4806:Plxnd1 UTSW 6 115960855 missense probably damaging 1.00
R4944:Plxnd1 UTSW 6 115955765 missense probably damaging 1.00
R4977:Plxnd1 UTSW 6 115994376 missense probably damaging 1.00
R5069:Plxnd1 UTSW 6 115965901 missense probably damaging 0.98
R5155:Plxnd1 UTSW 6 115958988 critical splice donor site probably null
R5460:Plxnd1 UTSW 6 115957648 missense probably damaging 1.00
R5729:Plxnd1 UTSW 6 115965877 missense probably damaging 1.00
R5909:Plxnd1 UTSW 6 115968688 missense probably benign 0.00
R5992:Plxnd1 UTSW 6 115967787 critical splice acceptor site probably null
R6129:Plxnd1 UTSW 6 115978174 missense probably damaging 1.00
R6254:Plxnd1 UTSW 6 115977960 missense probably benign 0.01
R6273:Plxnd1 UTSW 6 115978492 missense probably damaging 1.00
R6310:Plxnd1 UTSW 6 115976736 missense possibly damaging 0.94
R6732:Plxnd1 UTSW 6 115969929 missense possibly damaging 0.94
R6857:Plxnd1 UTSW 6 115993763 missense probably benign 0.05
R7243:Plxnd1 UTSW 6 115972507 missense probably benign 0.00
R7282:Plxnd1 UTSW 6 115960837 missense probably damaging 1.00
R7632:Plxnd1 UTSW 6 115976639 missense probably benign
R7699:Plxnd1 UTSW 6 115959794 missense probably damaging 0.96
R7915:Plxnd1 UTSW 6 115966918 missense probably benign 0.00
R8090:Plxnd1 UTSW 6 115956617 missense probably damaging 1.00
R8382:Plxnd1 UTSW 6 115972472 missense probably benign
R8507:Plxnd1 UTSW 6 115966905 missense probably damaging 0.97
X0024:Plxnd1 UTSW 6 115963310 missense probably benign 0.02
X0026:Plxnd1 UTSW 6 115966784 missense possibly damaging 0.88
Z1088:Plxnd1 UTSW 6 115967510 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGATCCTACCAATATCTGCCAC -3'
(R):5'- TTGGCCTCTGCACCAAACTC -3'

Sequencing Primer
(F):5'- GTGCCTAACCATGTCCACC -3'
(R):5'- TTGTCTGTGAGGCTCAGA -3'
Posted On2015-06-12