Incidental Mutation 'R9189:Vmn2r23'
ID 697594
Institutional Source Beutler Lab
Gene Symbol Vmn2r23
Ensembl Gene ENSMUSG00000091620
Gene Name vomeronasal 2, receptor 23
Synonyms EG435916
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9189 (G1)
Quality Score 142.008
Status Not validated
Chromosome 6
Chromosomal Location 123702821-123742291 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123704364 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 77 (H77L)
Ref Sequence ENSEMBL: ENSMUSP00000126682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172391]
AlphaFold E9PXI5
Predicted Effect probably benign
Transcript: ENSMUST00000172391
AA Change: H77L

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: H77L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 79 461 1.7e-31 PFAM
Pfam:NCD3G 513 566 1.2e-23 PFAM
Pfam:7tm_3 596 834 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox1 T A 11: 116,174,405 D608V probably damaging Het
Actg1 A T 11: 120,348,187 C26S unknown Het
Ahnak T A 19: 9,010,883 V3177E possibly damaging Het
Akap11 G A 14: 78,513,498 T483I Het
Akr1cl A G 1: 65,024,671 S120P probably benign Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Ankrd55 A T 13: 112,368,036 I439F probably damaging Het
Asb8 A G 15: 98,142,754 M9T possibly damaging Het
Ascc1 A T 10: 60,007,823 Y69F probably benign Het
Atp9a A T 2: 168,676,140 probably null Het
Cd8b1 T C 6: 71,329,768 F160L probably benign Het
Cdh23 G A 10: 60,307,527 A3005V possibly damaging Het
Cep250 A G 2: 155,976,430 T842A probably benign Het
Cgnl1 T A 9: 71,723,565 K552* probably null Het
Cntnap4 C T 8: 112,875,968 T1227M possibly damaging Het
Cobll1 C A 2: 65,150,989 V86F probably damaging Het
Dchs2 A G 3: 83,348,254 N2419S probably damaging Het
Dhx30 A T 9: 110,085,426 L1001* probably null Het
Diaph1 C T 18: 37,891,109 V559M unknown Het
Dis3l A T 9: 64,310,449 H783Q probably benign Het
Dock7 T G 4: 98,989,113 T1063P unknown Het
Dsc1 T C 18: 20,099,157 T265A possibly damaging Het
Eif2ak4 A T 2: 118,427,912 Q581L probably damaging Het
Eprs A T 1: 185,374,137 D183V possibly damaging Het
Fads2 G C 19: 10,091,819 D80E probably benign Het
Fam167b G A 4: 129,577,082 R158C probably damaging Het
Fam71a G A 1: 191,162,703 T581I possibly damaging Het
Flnb T A 14: 7,892,976 I682K possibly damaging Het
Gpatch2l C T 12: 86,244,378 P112S probably benign Het
Gpn1 T A 5: 31,497,366 H87Q unknown Het
Greb1l T C 18: 10,499,983 V350A probably benign Het
Grm5 A T 7: 88,074,816 K771N probably damaging Het
Gucy2c C T 6: 136,751,047 S319N probably benign Het
Hcfc2 G T 10: 82,699,207 A22S probably benign Het
Hist1h2bg A G 13: 23,571,587 D52G probably damaging Het
Hnf4a A G 2: 163,551,577 D39G probably benign Het
Il6st C T 13: 112,498,806 T584M probably damaging Het
Irf3 T A 7: 45,000,822 V254E possibly damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Kank4 T A 4: 98,780,052 K53* probably null Het
Kcnj11 A T 7: 46,098,752 F382L possibly damaging Het
Kcnq3 T C 15: 65,995,661 Y711C probably damaging Het
Kctd3 A G 1: 188,972,439 S712P possibly damaging Het
Krt20 A G 11: 99,432,261 I245T possibly damaging Het
Larp1b T C 3: 40,970,604 I219T probably damaging Het
Lman2l A G 1: 36,439,690 F114L probably damaging Het
Loxl2 T A 14: 69,692,410 Y746N possibly damaging Het
Lrrc43 T C 5: 123,508,046 S628P probably benign Het
Mroh8 A C 2: 157,269,625 D136E probably damaging Het
Nek8 T A 11: 78,172,516 M141L probably benign Het
Nr2e1 C A 10: 42,578,272 R22L probably damaging Het
Nr6a1 C T 2: 38,926,117 probably null Het
Olfr1164 A G 2: 88,093,850 F29L probably damaging Het
Olfr1167 T C 2: 88,149,564 M152V probably benign Het
Olfr1377 T A 11: 50,985,339 C213S probably damaging Het
Olfr3 T A 2: 36,812,202 M297L possibly damaging Het
Onecut2 A G 18: 64,340,819 Y147C probably damaging Het
Pcdhac2 T C 18: 37,144,263 F99L probably benign Het
Pcdhga2 T G 18: 37,669,742 V213G possibly damaging Het
Pgap1 A T 1: 54,480,749 V909E probably benign Het
Pik3r4 A T 9: 105,669,839 T939S probably benign Het
Pip4k2c T C 10: 127,199,377 D374G possibly damaging Het
Plxdc1 A T 11: 97,953,962 D252E probably benign Het
Pm20d1 A C 1: 131,802,377 D218A probably damaging Het
Polq C A 16: 37,044,903 Q706K probably damaging Het
Pram1 A T 17: 33,641,157 I233F probably benign Het
Prr27 C A 5: 87,843,135 P202Q probably benign Het
Prss41 A T 17: 23,842,387 H143Q probably damaging Het
Ptpn21 A G 12: 98,689,002 Y569H probably damaging Het
Rad17 T C 13: 100,637,056 K142E probably damaging Het
Rcan3 T C 4: 135,425,296 E38G probably benign Het
Rgl3 C A 9: 21,974,060 R658L possibly damaging Het
Rnf125 T A 18: 20,983,183 *141K probably null Het
Ros1 G T 10: 52,143,406 N711K probably damaging Het
Rsph10b T A 5: 143,959,686 Y421N probably benign Het
Ryr1 C T 7: 29,077,046 V2222I probably damaging Het
Samsn1 C T 16: 75,859,561 C333Y probably damaging Het
Slc9a2 G A 1: 40,755,784 E502K probably benign Het
Stard9 A T 2: 120,703,019 E3252D possibly damaging Het
Syne1 C A 10: 5,173,008 R309S probably damaging Het
Syne1 T C 10: 5,222,289 I5051V probably benign Het
Syngap1 A G 17: 26,964,974 S1241G probably damaging Het
Tbpl2 T C 2: 24,076,018 K321R probably damaging Het
Tnrc18 C T 5: 142,731,352 G2449E probably damaging Het
Trim25 A G 11: 89,010,905 D342G probably benign Het
Tssk4 T A 14: 55,650,447 H33Q probably benign Het
Ttc3 G A 16: 94,467,972 G1971D possibly damaging Het
Tufm C T 7: 126,489,677 Q347* probably null Het
Ubxn10 G A 4: 138,720,822 S181F possibly damaging Het
Ushbp1 T C 8: 71,388,895 E430G probably benign Het
Vmn1r33 T C 6: 66,611,732 I279M possibly damaging Het
Vmn2r115 T C 17: 23,345,810 F224L probably damaging Het
Vps13a T C 19: 16,686,597 I1481V probably benign Het
Vps35 T C 8: 85,281,269 N294S possibly damaging Het
Washc3 A T 10: 88,216,054 T102S probably benign Het
Zfp27 T A 7: 29,895,934 E202V possibly damaging Het
Zfp58 T C 13: 67,491,916 H152R possibly damaging Het
Zfr2 T C 10: 81,244,662 V390A probably damaging Het
Other mutations in Vmn2r23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Vmn2r23 APN 6 123729725 missense possibly damaging 0.89
IGL01012:Vmn2r23 APN 6 123729596 missense probably benign
IGL01073:Vmn2r23 APN 6 123712800 missense possibly damaging 0.82
IGL01547:Vmn2r23 APN 6 123704424 missense possibly damaging 0.88
IGL01571:Vmn2r23 APN 6 123704407 missense probably damaging 1.00
IGL01950:Vmn2r23 APN 6 123741886 missense possibly damaging 0.80
IGL02028:Vmn2r23 APN 6 123741860 missense probably damaging 1.00
IGL02248:Vmn2r23 APN 6 123741744 missense probably damaging 0.96
IGL02318:Vmn2r23 APN 6 123741836 missense probably benign 0.10
IGL02649:Vmn2r23 APN 6 123704478 missense probably benign
IGL02831:Vmn2r23 APN 6 123704385 missense probably benign 0.22
IGL02832:Vmn2r23 APN 6 123704396 missense probably benign 0.00
IGL02865:Vmn2r23 APN 6 123741619 missense probably damaging 1.00
IGL02964:Vmn2r23 APN 6 123741782 missense possibly damaging 0.93
IGL03347:Vmn2r23 APN 6 123704374 missense probably benign 0.01
IGL03396:Vmn2r23 APN 6 123729626 missense probably damaging 1.00
PIT4472001:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R0597:Vmn2r23 UTSW 6 123729721 missense probably benign 0.08
R0677:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R0904:Vmn2r23 UTSW 6 123742135 missense probably damaging 1.00
R1330:Vmn2r23 UTSW 6 123742004 missense probably damaging 1.00
R1424:Vmn2r23 UTSW 6 123713270 nonsense probably null
R1629:Vmn2r23 UTSW 6 123713427 missense probably benign 0.05
R1842:Vmn2r23 UTSW 6 123729690 missense possibly damaging 0.77
R1867:Vmn2r23 UTSW 6 123702915 missense probably damaging 1.00
R1919:Vmn2r23 UTSW 6 123713010 missense possibly damaging 0.94
R2087:Vmn2r23 UTSW 6 123741499 missense probably benign 0.00
R2338:Vmn2r23 UTSW 6 123704425 missense possibly damaging 0.88
R2568:Vmn2r23 UTSW 6 123742188 nonsense probably null
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R2867:Vmn2r23 UTSW 6 123713164 missense possibly damaging 0.94
R3500:Vmn2r23 UTSW 6 123713170 missense possibly damaging 0.81
R3789:Vmn2r23 UTSW 6 123741389 missense probably damaging 1.00
R4164:Vmn2r23 UTSW 6 123729738 missense probably benign
R4506:Vmn2r23 UTSW 6 123702925 missense probably damaging 1.00
R4652:Vmn2r23 UTSW 6 123741730 missense probably damaging 1.00
R4697:Vmn2r23 UTSW 6 123741826 missense probably damaging 1.00
R4840:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R4983:Vmn2r23 UTSW 6 123733349 missense probably damaging 1.00
R5276:Vmn2r23 UTSW 6 123712977 missense possibly damaging 0.62
R5392:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R5528:Vmn2r23 UTSW 6 123713002 missense probably damaging 1.00
R5529:Vmn2r23 UTSW 6 123713451 missense probably benign 0.00
R5664:Vmn2r23 UTSW 6 123713074 missense probably damaging 1.00
R5749:Vmn2r23 UTSW 6 123733273 missense probably benign
R5761:Vmn2r23 UTSW 6 123712759 missense probably benign 0.39
R5762:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
R5868:Vmn2r23 UTSW 6 123712942 missense probably benign 0.12
R5935:Vmn2r23 UTSW 6 123741895 missense possibly damaging 0.94
R6242:Vmn2r23 UTSW 6 123704400 missense possibly damaging 0.82
R6416:Vmn2r23 UTSW 6 123712902 missense probably damaging 1.00
R6524:Vmn2r23 UTSW 6 123713425 missense probably damaging 1.00
R6576:Vmn2r23 UTSW 6 123733273 missense probably benign
R6925:Vmn2r23 UTSW 6 123704553 missense probably damaging 1.00
R7148:Vmn2r23 UTSW 6 123713022 missense probably benign
R7215:Vmn2r23 UTSW 6 123704364 missense probably benign 0.36
R7252:Vmn2r23 UTSW 6 123741581 missense probably damaging 0.97
R7403:Vmn2r23 UTSW 6 123704579 missense probably benign 0.01
R8015:Vmn2r23 UTSW 6 123704541 missense probably benign 0.00
R8143:Vmn2r23 UTSW 6 123741353 missense probably damaging 0.99
R8474:Vmn2r23 UTSW 6 123704640 missense probably benign 0.36
R8520:Vmn2r23 UTSW 6 123741656 missense probably damaging 0.99
R8679:Vmn2r23 UTSW 6 123713472 missense probably damaging 0.99
R8713:Vmn2r23 UTSW 6 123703032 missense
R8966:Vmn2r23 UTSW 6 123742120 missense possibly damaging 0.94
R9124:Vmn2r23 UTSW 6 123742079 missense possibly damaging 0.57
R9163:Vmn2r23 UTSW 6 123741823 missense probably damaging 1.00
R9451:Vmn2r23 UTSW 6 123733393 missense probably damaging 1.00
RF018:Vmn2r23 UTSW 6 123713116 missense probably benign 0.00
T0975:Vmn2r23 UTSW 6 123713161 missense probably benign 0.00
Z1088:Vmn2r23 UTSW 6 123742108 missense probably damaging 0.98
Z1177:Vmn2r23 UTSW 6 123729725 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAATGTCCTGCTTGTTTCTTGGA -3'
(R):5'- AGGCCTACAACTGTAGTTAGGA -3'

Sequencing Primer
(F):5'- CCTGCTTGTTTCTTGGATTGTTGC -3'
(R):5'- GCCTACAACTGTAGTTAGGAATTGG -3'
Posted On 2022-02-07