Mutagenetix > Incidental Mutations

Incidental Mutation 'R8420:Muc16'

653146

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.159) question?

Stock #

R8420 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 18537511 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 7675 (T7675A)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000208663
AA Change: T7675A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933416C03Rik	T	C	10: 116,112,535	Y362C	probably benign	Het
Aatk	A	G	11: 120,046,920	S11P	unknown	Het
Adrb2	T	C	18: 62,178,933	T274A	probably damaging	Het
Aph1b	A	G	9: 66,794,221	S45P	probably damaging	Het
Atp9b	A	T	18: 80,844,591	D321E		Het
C1qbp	A	G	11: 70,978,717	V180A	possibly damaging	Het
C4b	G	T	17: 34,734,539	A990D	probably damaging	Het
Ccdc80	T	A	16: 45,095,249	S123T	possibly damaging	Het
Cdh18	A	C	15: 23,474,052	E669D	possibly damaging	Het
Ceacam3	T	A	7: 17,161,683	V526D		Het
Cenpf	C	T	1: 189,672,585	C349Y	probably damaging	Het
Dmrt2	T	C	19: 25,678,015	V326A	probably damaging	Het
Dock9	T	C	14: 121,546,042	Q2023R	probably damaging	Het
Exd2	A	G	12: 80,475,997	R77G	probably benign	Het
Exph5	A	T	9: 53,375,848	K1410*	probably null	Het
Eya2	A	G	2: 165,767,068	T443A	probably damaging	Het
Fam135a	G	A	1: 24,028,488	T1100M	probably benign	Het
Foxp2	G	T	6: 15,403,867	R381L	unknown	Het
Grm7	T	G	6: 111,080,354	V305G	probably benign	Het
Gzma	G	A	13: 113,100,930	R8W	probably benign	Het
H6pd	T	C	4: 149,981,676	E759G	probably benign	Het
Ift27	A	G	15: 78,164,191	V154A	probably benign	Het
Kif1a	A	T	1: 93,022,419	S1429T	probably benign	Het
Lrrn1	T	A	6: 107,569,333	D697E	probably benign	Het
Mcrs1	A	T	15: 99,243,694	I387N	probably damaging	Het
Naf1	GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC	GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC	8: 66,860,548		probably benign	Het
Nid1	C	A	13: 13,437,831	L44I	possibly damaging	Het
Olfr1046	T	A	2: 86,217,113	E199V	probably damaging	Het
Olfr197	A	G	16: 59,185,754	I243T	unknown	Het
Olfr452	A	T	6: 42,790,710	T224S	possibly damaging	Het
Olfr734	T	C	14: 50,320,776	T20A	probably benign	Het
Pde11a	C	T	2: 76,059,010	D707N	probably damaging	Het
Pigf	A	T	17: 87,020,482	L119*	probably null	Het
Pkd1l1	A	T	11: 8,870,277	C1679*	probably null	Het
Prnp	A	G	2: 131,936,749	N107S	probably benign	Het
Ptgfr	C	T	3: 151,835,416	V152M	possibly damaging	Het
Rap2b	A	G	3: 61,364,384		probably benign	Het
Rtn4	A	G	11: 29,707,300	T485A	probably damaging	Het
Sec23b	A	G	2: 144,559,314	T32A	probably benign	Het
Skint5	A	T	4: 113,580,482		probably null	Het
Slc13a5	A	G	11: 72,257,384	L275P	probably damaging	Het
Slc20a1	C	T	2: 129,199,864	A49V	probably damaging	Het
Slc35g2	A	G	9: 100,553,171	I149T	probably benign	Het
Syk	T	A	13: 52,624,727	I283K	probably benign	Het
Tnfsf13b	G	A	8: 10,006,795		probably benign	Het
Ubr1	A	G	2: 120,870,995	V1592A	probably benign	Het
Vopp1	T	C	6: 57,762,394	*123W	probably null	Het
Xpo4	T	A	14: 57,604,456	Q467H	probably damaging	Het
Zdhhc22	A	C	12: 86,988,369	V103G	possibly damaging	Het
Zfp868	A	G	8: 69,611,509	S392P	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R7038_muc16_859	UTSW	9	18620468	missense	probably damaging	0.99
Runneymeade	UTSW	9	18579317	critical splice donor site	probably null
slimey	UTSW	9	18590698	missense	probably damaging	1.00
viscous	UTSW	9	18644732	missense	unknown
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	splice site	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	splice site	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7070:Muc16	UTSW	9	18645923	nonsense	probably null
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00
R7581:Muc16	UTSW	9	18645614	missense	unknown
R7594:Muc16	UTSW	9	18645062	missense	unknown
R7629:Muc16	UTSW	9	18566785	missense	possibly damaging	0.86
R7664:Muc16	UTSW	9	18607722	missense	probably benign	0.08
R7666:Muc16	UTSW	9	18558427	missense	probably damaging	1.00
R7703:Muc16	UTSW	9	18605282	missense
R7727:Muc16	UTSW	9	18660242	missense	unknown
R7743:Muc16	UTSW	9	18657477	missense	unknown
R7744:Muc16	UTSW	9	18585096	critical splice acceptor site	probably null
R7761:Muc16	UTSW	9	18580574	missense	probably damaging	1.00
R7769:Muc16	UTSW	9	18660507	missense	unknown
R7805:Muc16	UTSW	9	18638493	missense	possibly damaging	0.94
R7827:Muc16	UTSW	9	18595223	missense	possibly damaging	0.83
R7845:Muc16	UTSW	9	18640773	missense	probably benign	0.01
R7849:Muc16	UTSW	9	18640505	missense	probably benign	0.01
R7884:Muc16	UTSW	9	18642694	missense	unknown
R7885:Muc16	UTSW	9	18639464	missense	probably benign	0.10
R7886:Muc16	UTSW	9	18585982	missense	probably benign	0.03
R7899:Muc16	UTSW	9	18640697	missense	probably benign	0.01
R7904:Muc16	UTSW	9	18655650	missense	unknown
R7921:Muc16	UTSW	9	18659318	missense	unknown
R7922:Muc16	UTSW	9	18584825	missense	probably benign	0.16
R7948:Muc16	UTSW	9	18642490	missense	unknown
R7957:Muc16	UTSW	9	18643471	missense	unknown
R7972:Muc16	UTSW	9	18645764	nonsense	probably null
R7992:Muc16	UTSW	9	18656429	missense	unknown
R7998:Muc16	UTSW	9	18639892	missense	probably benign	0.04
R8014:Muc16	UTSW	9	18654875	missense	unknown
R8033:Muc16	UTSW	9	18636606	missense	probably benign	0.26
R8052:Muc16	UTSW	9	18659051	missense	unknown
R8058:Muc16	UTSW	9	18660002	nonsense	probably null
R8088:Muc16	UTSW	9	18519300	nonsense	probably null
R8095:Muc16	UTSW	9	18584830	nonsense	probably null
R8111:Muc16	UTSW	9	18592629	missense	possibly damaging	0.55
R8116:Muc16	UTSW	9	18658737	missense	unknown
R8117:Muc16	UTSW	9	18508910	nonsense	probably null
R8137:Muc16	UTSW	9	18645676	missense	unknown
R8196:Muc16	UTSW	9	18645334	missense	unknown
R8218:Muc16	UTSW	9	18637019	missense	possibly damaging	0.48
R8285:Muc16	UTSW	9	18642977	missense	unknown
R8313:Muc16	UTSW	9	18525147	missense	possibly damaging	0.85
R8317:Muc16	UTSW	9	18658043	missense	unknown
R8342:Muc16	UTSW	9	18658685	missense	unknown
R8351:Muc16	UTSW	9	18659885	missense	unknown
R8356:Muc16	UTSW	9	18658778	missense	unknown
R8360:Muc16	UTSW	9	18525258	missense	probably benign	0.01
R8418:Muc16	UTSW	9	18519630	missense	possibly damaging	0.94
R8437:Muc16	UTSW	9	18657924	missense	unknown
R8463:Muc16	UTSW	9	18659139	missense	unknown
R8466:Muc16	UTSW	9	18643148	missense	unknown
R8512:Muc16	UTSW	9	18638192	missense	probably benign	0.01
R8518:Muc16	UTSW	9	18519631	missense	probably benign	0.12
R8556:Muc16	UTSW	9	18640937	missense	probably benign	0.01
R8679:Muc16	UTSW	9	18646448	missense	unknown
R8680:Muc16	UTSW	9	18644719	missense	unknown
R8720:Muc16	UTSW	9	18641600	missense	probably benign	0.01
R8729:Muc16	UTSW	9	18660050	missense	unknown
R8736:Muc16	UTSW	9	18550843	nonsense	probably null
R8739:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R8807:Muc16	UTSW	9	18656057	missense	unknown
R8830:Muc16	UTSW	9	18646069	missense	unknown
R8871:Muc16	UTSW	9	18656048	missense	unknown
R8884:Muc16	UTSW	9	18644200	missense	unknown
R8923:Muc16	UTSW	9	18638676	missense	probably benign	0.01
R8948:Muc16	UTSW	9	18647233	missense	unknown
R8949:Muc16	UTSW	9	18520925	critical splice donor site	probably null
R8987:Muc16	UTSW	9	18551685	nonsense	probably null
R8997:Muc16	UTSW	9	18607467	intron	probably benign
R9013:Muc16	UTSW	9	18512773	missense	possibly damaging	0.94
R9020:Muc16	UTSW	9	18638719	small insertion	probably benign
R9036:Muc16	UTSW	9	18644679	missense	unknown
R9040:Muc16	UTSW	9	18644786	nonsense	probably null
R9065:Muc16	UTSW	9	18643009	missense	unknown
R9089:Muc16	UTSW	9	18644550	missense	unknown
R9098:Muc16	UTSW	9	18643679	missense	unknown
R9100:Muc16	UTSW	9	18645670	missense	unknown
R9128:Muc16	UTSW	9	18647582	missense	unknown
R9169:Muc16	UTSW	9	18656528	missense	unknown
R9180:Muc16	UTSW	9	18642742	missense	unknown
R9191:Muc16	UTSW	9	18644810	missense	unknown
R9203:Muc16	UTSW	9	18551688	missense	unknown
R9208:Muc16	UTSW	9	18508537	missense	probably damaging	0.99
R9232:Muc16	UTSW	9	18656040	missense	unknown
R9240:Muc16	UTSW	9	18538013	missense	unknown
R9254:Muc16	UTSW	9	18646171	missense	unknown
R9330:Muc16	UTSW	9	18641036	missense	probably benign	0.04
R9347:Muc16	UTSW	9	18660215	missense	unknown
R9358:Muc16	UTSW	9	18642224	missense	probably benign	0.01
R9359:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9379:Muc16	UTSW	9	18646171	missense	unknown
R9403:Muc16	UTSW	9	18537764	critical splice donor site	probably null
R9422:Muc16	UTSW	9	18641806	missense	probably benign	0.01
R9433:Muc16	UTSW	9	18572641	missense	probably benign	0.09
R9438:Muc16	UTSW	9	18647732	missense	unknown
R9442:Muc16	UTSW	9	18655328	missense	unknown
R9453:Muc16	UTSW	9	18660765	missense	unknown
R9467:Muc16	UTSW	9	18597035	missense	probably benign	0.03
Z1177:Muc16	UTSW	9	18537571	missense	probably benign	0.26
Z1177:Muc16	UTSW	9	18657861	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCAACATGCTACTTGTGGGTG -3'
(R):5'- GCTGTAGACTGACCTCCCTAAG -3'

Sequencing Primer
(F):5'- GTGCTTCTGAAATTTTTGAAGGAAG -3'
(R):5'- CTTGACACTTTCATCCACATTAGG -3'

Posted On

2020-10-20