Mutagenetix > Incidental Mutation

Incidental Mutation 'R7498:Trpm1'

581209

Institutional Source

Beutler Lab

Gene Symbol

Trpm1

Ensembl Gene

ENSMUSG00000030523

Gene Name

transient receptor potential cation channel, subfamily M, member 1

Synonyms

Mlsn1, 4732499L03Rik, LTRPC1, melastatin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7498 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64153835-64269775 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64208909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 360 (I360F)

Ref Sequence

ENSEMBL: ENSMUSP00000082318 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085222] [ENSMUST00000177102] [ENSMUST00000205348] [ENSMUST00000205731] [ENSMUST00000205994] [ENSMUST00000206263] [ENSMUST00000206277] [ENSMUST00000206314] [ENSMUST00000206706]

AlphaFold

Q2TV84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085222
AA Change: I360F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082318
Gene: ENSMUSG00000030523
AA Change: I360F

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
low complexity region	183	195	N/A	INTRINSIC
low complexity region	289	307	N/A	INTRINSIC
low complexity region	456	491	N/A	INTRINSIC
Blast:ANK	505	533	1e-5	BLAST
low complexity region	621	650	N/A	INTRINSIC
low complexity region	823	835	N/A	INTRINSIC
transmembrane domain	876	895	N/A	INTRINSIC
Pfam:Ion_trans	907	1120	6e-16	PFAM
transmembrane domain	1150	1167	N/A	INTRINSIC
low complexity region	1216	1225	N/A	INTRINSIC
PDB:3E7K\|H	1228	1279	1e-7	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177102
AA Change: I244F

PolyPhen 2 Score 0.603 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134947
Gene: ENSMUSG00000030523
AA Change: I244F

Domain	Start	End	E-Value	Type
low complexity region	67	79	N/A	INTRINSIC
low complexity region	173	191	N/A	INTRINSIC
low complexity region	340	375	N/A	INTRINSIC
Blast:ANK	389	417	1e-5	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000205348
AA Change: I360F

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

Predicted Effect

probably benign
Transcript: ENSMUST00000205684

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205731
AA Change: I244F

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000205994

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206263
AA Change: I244F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206277
AA Change: I360F

PolyPhen 2 Score 0.498 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000206314

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206706
AA Change: I227F

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)

Meta Mutation Damage Score

0.1845

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the transient receptor potential melastatin subfamily of transient receptor potential ion channels. The encoded protein is a calcium permeable cation channel that is expressed in melanocytes and may play a role in melanin synthesis. Specific mutations in this gene are the cause autosomal recessive complete congenital stationary night blindness-1C. The expression of this protein is inversely correlated with melanoma aggressiveness and as such it is used as a prognostic marker for melanoma metastasis. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutants have defects in rod and cone electrophysiology affecting the photoresponses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	G	A	2: 68,667,668	E148K	unknown	Het
4932415D10Rik	T	A	10: 82,291,279	T1966S	probably benign	Het
Adgrl2	T	A	3: 148,859,216	K243*	probably null	Het
Adgrv1	A	T	13: 81,440,225	V4414E	possibly damaging	Het
Ahnak	A	T	19: 9,012,019	I3556F	probably benign	Het
Akap6	C	T	12: 53,142,705	R2301*	probably null	Het
Alg6	A	G	4: 99,748,696	T305A	probably damaging	Het
Alpk1	C	T	3: 127,679,778	A859T	probably benign	Het
Apba3	T	A	10: 81,268,901	F3I	possibly damaging	Het
Birc6	A	G	17: 74,660,470	E4151G	probably damaging	Het
Bmp2k	T	A	5: 97,088,119	F1134I	probably benign	Het
C6	A	T	15: 4,763,364	H317L	probably damaging	Het
Catsperg2	G	A	7: 29,717,102	S295L	possibly damaging	Het
Ccdc142	G	T	6: 83,103,231	R385L	possibly damaging	Het
Ccdc151	A	G	9: 22,002,257	I73T	probably damaging	Het
Ciz1	A	T	2: 32,371,749	M482L	probably benign	Het
Crisp3	A	G	17: 40,225,802		probably null	Het
Dcaf15	G	A	8: 84,101,763	P233S	probably damaging	Het
Def8	A	G	8: 123,447,844	N16S	probably damaging	Het
Dnah7b	T	G	1: 46,325,765	S3569A	probably damaging	Het
Dok6	C	T	18: 89,769,319		probably benign	Het
Dopey1	A	T	9: 86,494,411	T233S	possibly damaging	Het
Ep300	T	A	15: 81,639,843	V1325D	unknown	Het
Fancm	T	A	12: 65,099,391	H629Q	probably benign	Het
Fbxo10	T	C	4: 45,062,194	S111G	probably benign	Het
Fbxo21	T	C	5: 118,002,174		probably null	Het
Fdx1	A	C	9: 51,948,598	L144R	probably damaging	Het
Fgfr3	GGACCTCTCCGTG	GG	5: 33,735,422		probably null	Het
Flot2	G	A	11: 78,053,362		probably null	Het
Fndc10	C	T	4: 155,694,738	R80C	probably damaging	Het
Fut8	A	T	12: 77,412,934	T274S	probably benign	Het
Gli2	T	C	1: 118,835,835	M1529V	possibly damaging	Het
Gm7361	C	A	5: 26,261,190	H183Q	probably benign	Het
Gm7697	A	C	8: 69,519,823	Y91*	probably null	Het
Hdlbp	T	A	1: 93,413,615	H1007L	probably benign	Het
Hmcn2	A	C	2: 31,383,475		probably null	Het
Inhbb	C	T	1: 119,417,878	R227H	probably damaging	Het
Kifc1	A	G	17: 33,883,872	F256L	probably benign	Het
Lman2	A	T	13: 55,346,977	F326Y	probably damaging	Het
Mcmdc2	T	C	1: 9,919,077	V242A	probably benign	Het
Mettl8	A	C	2: 70,965,625	V306G	probably damaging	Het
Mog	A	T	17: 37,012,092		probably null	Het
Morc2b	G	A	17: 33,137,859	A313V	possibly damaging	Het
Myh3	A	G	11: 67,097,048	N1449S	possibly damaging	Het
Myh8	C	A	11: 67,283,437	T200K	possibly damaging	Het
Myo16	T	A	8: 10,400,589	H530Q	unknown	Het
Neb	C	T	2: 52,258,176	R2686H	probably damaging	Het
Nudt2	T	C	4: 41,480,539	F141L	possibly damaging	Het
Obscn	G	A	11: 59,082,713	H1931Y	probably damaging	Het
Olfr121	A	G	17: 37,752,351	T166A	probably damaging	Het
Olfr508	T	A	7: 108,630,416	C141*	probably null	Het
Olfr710	A	T	7: 106,944,368	V211D	possibly damaging	Het
Plcb1	T	A	2: 135,262,233	L274*	probably null	Het
Plcb1	G	T	2: 135,262,234	L274F	probably damaging	Het
Prc1	C	T	7: 80,313,150	T564M	possibly damaging	Het
Psd4	G	A	2: 24,406,984	R923Q	probably damaging	Het
Ptprj	G	A	2: 90,436,565	Q1300*	probably null	Het
Rapgef6	G	T	11: 54,620,004	R249L	probably damaging	Het
Slain1	G	A	14: 103,655,993		probably null	Het
Slfn9	A	T	11: 82,982,187	I630N	probably damaging	Het
Smg6	G	A	11: 74,929,106	A68T	probably benign	Het
Spef2	T	A	15: 9,727,539	M153L	probably benign	Het
St8sia4	T	A	1: 95,591,693	M357L	probably benign	Het
Tal1	A	T	4: 115,068,682	H316L	possibly damaging	Het
Tenm4	A	G	7: 96,848,017	E1207G	probably damaging	Het
Tmem64	C	A	4: 15,266,176	H75Q	probably benign	Het
Tor4a	A	G	2: 25,195,792	V33A	probably benign	Het
Traj52	C	T	14: 54,165,361	T15I		Het
Trim50	G	A	5: 135,363,914	V228M	probably benign	Het
Trpm6	A	T	19: 18,876,120	R1835W	probably damaging	Het
Ubn1	T	C	16: 5,077,105	S672P	probably damaging	Het
Ugt2a2	C	T	5: 87,474,641	C156Y	probably damaging	Het
Wnk1	T	C	6: 119,927,196	S2223G	unknown	Het
Wnt7b	G	T	15: 85,543,679	A194E	probably damaging	Het
Zmpste24	A	G	4: 121,082,831	V206A	probably benign	Het

Other mutations in Trpm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Trpm1	APN	7	64243450	missense	probably damaging	1.00
IGL00465:Trpm1	APN	7	64247467	missense	possibly damaging	0.94
IGL01118:Trpm1	APN	7	64235824	missense	probably benign	0.24
IGL01148:Trpm1	APN	7	64243564	missense	probably damaging	1.00
IGL01303:Trpm1	APN	7	64210830	critical splice acceptor site	probably benign	0.00
IGL01432:Trpm1	APN	7	64235019	missense	probably benign	0.18
IGL01433:Trpm1	APN	7	64204528	missense	probably damaging	1.00
IGL01506:Trpm1	APN	7	64243581	missense	probably damaging	1.00
IGL01626:Trpm1	APN	7	64268889	missense	probably damaging	1.00
IGL01640:Trpm1	APN	7	64226897	missense	probably damaging	1.00
IGL01899:Trpm1	APN	7	64234994	missense	probably benign	0.24
IGL01959:Trpm1	APN	7	64208975	missense	possibly damaging	0.81
IGL02210:Trpm1	APN	7	64210865	missense	probably damaging	1.00
IGL02268:Trpm1	APN	7	64217614	missense	probably damaging	0.96
IGL02331:Trpm1	APN	7	64235052	missense	probably benign	0.30
IGL02334:Trpm1	APN	7	64245942	critical splice acceptor site	probably null
IGL02407:Trpm1	APN	7	64219121	missense	probably damaging	1.00
IGL02425:Trpm1	APN	7	64240427	missense	probably damaging	0.96
IGL02485:Trpm1	APN	7	64269114	missense	possibly damaging	0.52
IGL02635:Trpm1	APN	7	64199224	missense	probably benign	0.00
IGL02640:Trpm1	APN	7	64219133	missense	probably damaging	0.97
IGL02827:Trpm1	APN	7	64219160	missense	probably null	1.00
PIT4458001:Trpm1	UTSW	7	64268561	missense	possibly damaging	0.94
PIT4544001:Trpm1	UTSW	7	64199250	intron	probably benign
R0012:Trpm1	UTSW	7	64268591	missense	possibly damaging	0.88
R0014:Trpm1	UTSW	7	64248222	missense	probably damaging	1.00
R0056:Trpm1	UTSW	7	64243586	missense	probably damaging	1.00
R0445:Trpm1	UTSW	7	64244842	unclassified	probably benign
R0463:Trpm1	UTSW	7	64220254	missense	probably benign	0.05
R0469:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R0510:Trpm1	UTSW	7	64223758	missense	probably damaging	1.00
R1301:Trpm1	UTSW	7	64203053	splice site	probably null
R1397:Trpm1	UTSW	7	64217658	missense	probably damaging	1.00
R1588:Trpm1	UTSW	7	64223817	missense	possibly damaging	0.93
R1618:Trpm1	UTSW	7	64240535	missense	probably damaging	1.00
R1724:Trpm1	UTSW	7	64235821	nonsense	probably null
R1827:Trpm1	UTSW	7	64235007	missense	probably damaging	1.00
R1829:Trpm1	UTSW	7	64226782	missense	probably damaging	1.00
R1835:Trpm1	UTSW	7	64230268	missense	probably damaging	1.00
R1864:Trpm1	UTSW	7	64268016	missense	probably damaging	1.00
R1895:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1946:Trpm1	UTSW	7	64223808	missense	probably damaging	1.00
R1959:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1960:Trpm1	UTSW	7	64230230	missense	probably damaging	1.00
R1980:Trpm1	UTSW	7	64208434	missense	possibly damaging	0.83
R1989:Trpm1	UTSW	7	64209032	intron	probably null
R2054:Trpm1	UTSW	7	64240555	missense	possibly damaging	0.69
R2156:Trpm1	UTSW	7	64234988	missense	probably damaging	1.00
R2251:Trpm1	UTSW	7	64209976	missense	probably damaging	1.00
R3051:Trpm1	UTSW	7	64269101	missense	probably damaging	1.00
R3148:Trpm1	UTSW	7	64235012	missense	probably benign	0.00
R3195:Trpm1	UTSW	7	64199313	nonsense	probably null
R3615:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3616:Trpm1	UTSW	7	64243570	missense	probably damaging	1.00
R3623:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3624:Trpm1	UTSW	7	64244853	missense	probably damaging	1.00
R3721:Trpm1	UTSW	7	64217727	intron	probably benign
R3822:Trpm1	UTSW	7	64217703	intron	probably benign
R4441:Trpm1	UTSW	7	64201918	missense	probably damaging	1.00
R4490:Trpm1	UTSW	7	64208912	nonsense	probably null
R4666:Trpm1	UTSW	7	64203034	missense	probably damaging	1.00
R4701:Trpm1	UTSW	7	64243500	missense	probably damaging	1.00
R4781:Trpm1	UTSW	7	64235052	missense	probably benign	0.30
R4811:Trpm1	UTSW	7	64208306	missense	probably damaging	1.00
R5017:Trpm1	UTSW	7	64244832	unclassified	probably benign
R5030:Trpm1	UTSW	7	64235831	missense	probably damaging	1.00
R5195:Trpm1	UTSW	7	64237693	missense	possibly damaging	0.84
R5238:Trpm1	UTSW	7	64268954	missense	probably damaging	1.00
R5304:Trpm1	UTSW	7	64208946	missense	probably benign	0.00
R5575:Trpm1	UTSW	7	64220270	missense	possibly damaging	0.95
R5613:Trpm1	UTSW	7	64208411	missense	probably damaging	1.00
R5855:Trpm1	UTSW	7	64268962	nonsense	probably null
R5947:Trpm1	UTSW	7	64223799	missense	probably benign	0.07
R5988:Trpm1	UTSW	7	64226805	missense	probably benign	0.16
R6054:Trpm1	UTSW	7	64268702	missense	probably benign	0.00
R6088:Trpm1	UTSW	7	64267976	missense	probably damaging	0.98
R6259:Trpm1	UTSW	7	64268478	missense	possibly damaging	0.47
R6379:Trpm1	UTSW	7	64199194	missense	probably benign	0.00
R6380:Trpm1	UTSW	7	64268297	missense	probably benign	0.24
R6429:Trpm1	UTSW	7	64268504	missense	probably benign	0.00
R6600:Trpm1	UTSW	7	64154033	start codon destroyed	probably null	0.56
R6622:Trpm1	UTSW	7	64240595	missense	probably damaging	0.96
R6939:Trpm1	UTSW	7	64268297	missense	probably benign	0.03
R6944:Trpm1	UTSW	7	64243433	missense	probably damaging	1.00
R7025:Trpm1	UTSW	7	64226714	critical splice acceptor site	probably null
R7112:Trpm1	UTSW	7	64235845	missense	probably damaging	0.97
R7168:Trpm1	UTSW	7	64268697	missense	probably benign	0.01
R7219:Trpm1	UTSW	7	64204585	missense	possibly damaging	0.68
R7224:Trpm1	UTSW	7	64219106	critical splice acceptor site	probably null
R7285:Trpm1	UTSW	7	64209981	nonsense	probably null
R7367:Trpm1	UTSW	7	64268801	missense	probably benign	0.06
R7449:Trpm1	UTSW	7	64208975	missense	probably benign	0.14
R7466:Trpm1	UTSW	7	64240582	missense	probably damaging	0.99
R7581:Trpm1	UTSW	7	64204555	missense	probably benign	0.00
R7776:Trpm1	UTSW	7	64248191	missense	probably benign	0.04
R8062:Trpm1	UTSW	7	64201941	missense	probably benign	0.18
R8069:Trpm1	UTSW	7	64208970	missense	possibly damaging	0.55
R8157:Trpm1	UTSW	7	64199269	missense	probably damaging	1.00
R8219:Trpm1	UTSW	7	64201951	missense	probably benign	0.35
R8258:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8259:Trpm1	UTSW	7	64269029	missense	probably benign	0.10
R8320:Trpm1	UTSW	7	64268793	missense	possibly damaging	0.56
R8536:Trpm1	UTSW	7	64247407	missense	probably damaging	1.00
R8544:Trpm1	UTSW	7	64224608	splice site	probably null
R8813:Trpm1	UTSW	7	64202008	missense	possibly damaging	0.68
R8912:Trpm1	UTSW	7	64268880	missense	probably benign	0.06
R8954:Trpm1	UTSW	7	64208341	missense	probably damaging	0.98
R9139:Trpm1	UTSW	7	64199195	missense	probably benign	0.00
R9205:Trpm1	UTSW	7	64240571	missense	possibly damaging	0.66
R9258:Trpm1	UTSW	7	64234965	missense	probably benign	0.01
R9283:Trpm1	UTSW	7	64223875	missense	probably benign	0.18
R9394:Trpm1	UTSW	7	64268732	missense	probably benign	0.00
R9430:Trpm1	UTSW	7	64223698	missense	probably benign	0.38
R9537:Trpm1	UTSW	7	64153868	unclassified	probably benign
R9616:Trpm1	UTSW	7	64208384	missense	probably damaging	0.99
R9774:Trpm1	UTSW	7	64248293	missense	possibly damaging	0.90
X0026:Trpm1	UTSW	7	64268910	missense	probably benign	0.05
Z1176:Trpm1	UTSW	7	64203131	critical splice donor site	probably null
Z1176:Trpm1	UTSW	7	64204594	critical splice donor site	probably null
Z1177:Trpm1	UTSW	7	64217691	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CTTGCAAAGAGCTAAACGCAGG -3'
(R):5'- AGATGGCCCATCAAGCAAGC -3'

Sequencing Primer
(F):5'- GCAGGCCAATTTTTAATGCTGC -3'
(R):5'- GCATGGCAGAGCTAGACAC -3'

Posted On

2019-10-17