Mutagenetix > Incidental Mutations

Incidental Mutation 'R2220:Cfap65'

241396

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

040222-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R2220 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74904025 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1614 (I1614V)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083682

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: I1614V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: I1614V

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160540

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 36,875,530		probably null	Het
Aadacl4	T	C	4: 144,618,002	I116T	probably damaging	Het
Aatk	G	T	11: 120,012,177	F407L	probably damaging	Het
Abca8a	A	T	11: 110,026,855	L1586Q	probably damaging	Het
Aox2	A	G	1: 58,349,130		probably null	Het
Ap5m1	A	G	14: 49,081,095	D420G	probably damaging	Het
Bcl6	A	T	16: 23,972,632	L324*	probably null	Het
Bicc1	A	G	10: 70,950,125	S396P	probably damaging	Het
Ccdc83	G	A	7: 90,259,514	S4L	probably damaging	Het
Cdkal1	T	A	13: 29,354,758	M473L	probably benign	Het
Cep85	T	C	4: 134,153,867	H363R	probably damaging	Het
Cfap61	G	A	2: 146,036,816		probably null	Het
Cluh	T	A	11: 74,667,121	F1062I	probably damaging	Het
Cntnap5a	A	T	1: 116,580,639	T1294S	possibly damaging	Het
Cops8	A	C	1: 90,606,619	N94T	probably benign	Het
Csmd1	T	C	8: 15,992,641	D2364G	possibly damaging	Het
Cyb5d1	T	C	11: 69,395,045	D55G	probably benign	Het
Cyp2c29	A	T	19: 39,287,232	I39F	probably benign	Het
Cyp2j8	T	C	4: 96,444,625	S495G	probably benign	Het
Dhx30	A	G	9: 110,087,635	L575P	probably damaging	Het
Dnah7a	C	T	1: 53,521,174	V2113I	probably benign	Het
Dusp3	T	C	11: 101,974,805	N95D	probably damaging	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Fam208b	A	T	13: 3,581,872	N876K	probably benign	Het
Fer1l4	T	G	2: 156,031,764	Y1207S	probably damaging	Het
Flg2	T	G	3: 93,202,185	S507A	unknown	Het
Gdf6	A	G	4: 9,844,770	H98R	probably damaging	Het
Ggnbp2	T	C	11: 84,836,613	N63S	possibly damaging	Het
Ggt7	A	G	2: 155,495,719	S504P	probably damaging	Het
Gm14548	A	T	7: 3,897,489	N87K	probably benign	Het
Gtf2h5	G	A	17: 6,084,578	E48K	probably benign	Het
Hivep3	T	G	4: 119,734,038	V81G	possibly damaging	Het
Igsf21	A	G	4: 140,028,114	M410T	probably damaging	Het
Insrr	T	C	3: 87,809,418	L651P	probably damaging	Het
Iqcb1	A	T	16: 36,843,462		probably null	Het
Klhdc7a	G	A	4: 139,965,453	R728C	probably benign	Het
Lars2	T	C	9: 123,418,780	L334P	probably damaging	Het
Mast3	T	C	8: 70,780,963	E994G	probably damaging	Het
Mertk	T	A	2: 128,801,472	N930K	probably benign	Het
Mettl21a	A	T	1: 64,616,283	V46E	probably damaging	Het
Nedd4	T	A	9: 72,736,707	C614S	probably damaging	Het
Olfr168	A	T	16: 19,530,145	Y258*	probably null	Het
Olfr173	G	T	16: 58,797,624	A74D	possibly damaging	Het
Olfr525	T	C	7: 140,323,571	S291P	probably benign	Het
Pard3b	C	T	1: 62,479,683	R976*	probably null	Het
Pcdhb16	A	G	18: 37,478,967	T327A	probably benign	Het
Ppp1r37	C	A	7: 19,532,446	R465L	probably null	Het
Ppp3ca	C	A	3: 136,797,924	T86K	probably damaging	Het
Ralgapa2	G	A	2: 146,421,679	T706I	probably benign	Het
Rnf213	T	C	11: 119,436,428	L1747P	possibly damaging	Het
Slc11a1	T	A	1: 74,380,665	F166I	probably damaging	Het
Slc25a18	G	A	6: 120,793,557		probably null	Het
Stt3a	A	G	9: 36,749,551		probably null	Het
Supt16	G	A	14: 52,172,144	R770*	probably null	Het
Syde2	A	G	3: 146,001,958	I551V	probably benign	Het
Tecta	T	C	9: 42,392,030	D102G	probably damaging	Het
Tmc7	A	T	7: 118,552,816	I294N	possibly damaging	Het
Tmem174	T	C	13: 98,637,259	Y21C	probably damaging	Het
Tomm40l	A	T	1: 171,221,981	L13*	probably null	Het
Trim30c	A	G	7: 104,383,267	V284A	probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Uggt2	A	T	14: 119,075,337	N353K	probably damaging	Het
Vps13d	C	T	4: 145,178,320	V79M	probably damaging	Het
Wfdc18	C	T	11: 83,709,913	R45*	probably null	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCTTCAAGCCTGCCACAG -3'
(R):5'- GCCTAGTAGTTTTCCAAGTCCAC -3'

Sequencing Primer
(F):5'- CCAGGATTCAGGCTGAAGGC -3'
(R):5'- AGTAGTTTTCCAAGTCCACTCAGG -3'

Posted On

2014-10-15