Mutagenetix > Incidental Mutation

Incidental Mutation 'R2291:Cfap65'

244313

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

040290-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R2291 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 74926475 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 459 (P459S)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: P459S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: P459S

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,413,801	I247N	probably damaging	Het
Afdn	A	G	17: 13,888,891	K1559E	probably damaging	Het
Ankhd1	C	T	18: 36,644,333	T1523I	probably benign	Het
Apc	T	A	18: 34,312,491	N795K	probably benign	Het
Arhgap26	G	T	18: 39,357,698		probably benign	Het
Atm	C	T	9: 53,490,909		probably null	Het
Atp1a4	T	C	1: 172,244,906	N394D	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Cacna1d	G	T	14: 30,042,342	R2078S	probably damaging	Het
Cacna1e	T	C	1: 154,403,683	D1720G	probably damaging	Het
Camk2a	T	A	18: 60,963,959	V38E	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccr7	G	A	11: 99,145,335	R254C	probably damaging	Het
Celf5	C	T	10: 81,467,047	G267D	probably damaging	Het
Chd1l	T	C	3: 97,591,283	K267E	probably damaging	Het
Chl1	T	A	6: 103,715,393	Y331N	probably damaging	Het
Cltc	G	A	11: 86,733,622	T158I	probably benign	Het
Col16a1	T	A	4: 130,067,040	D430E	unknown	Het
Cspg4	T	C	9: 56,892,743	V1597A	probably damaging	Het
Cstf2t	T	A	19: 31,084,864	L600H	probably benign	Het
Cyp27b1	T	C	10: 127,048,294	V5A	possibly damaging	Het
Depdc5	C	A	5: 32,979,402	Q1339K	probably damaging	Het
Diaph3	G	T	14: 86,966,446	P592Q	probably damaging	Het
Epha8	T	C	4: 136,933,347	M687V	probably damaging	Het
Fhod1	T	A	8: 105,336,964		probably benign	Het
Gls2	C	A	10: 128,207,610	S73*	probably null	Het
Gm3604	T	A	13: 62,371,843	M33L	probably damaging	Het
Gpr39	A	G	1: 125,677,541	T69A	probably benign	Het
Hal	T	C	10: 93,503,536	F496L	probably damaging	Het
Hipk1	T	C	3: 103,761,610	E490G	probably damaging	Het
Ints7	T	G	1: 191,606,203		probably null	Het
Itpr3	A	G	17: 27,113,579	E1799G	possibly damaging	Het
Kif11	T	A	19: 37,407,003	M570K	probably benign	Het
Kif18b	G	T	11: 102,908,270	Q702K	probably damaging	Het
Kif19a	A	G	11: 114,790,193	T247A	probably damaging	Het
Lama3	A	G	18: 12,525,079	E360G	probably damaging	Het
Loxl3	G	T	6: 83,037,488	A126S	probably benign	Het
Mc5r	C	T	18: 68,339,364	R265W	probably damaging	Het
Mpl	A	G	4: 118,449,000	V340A	probably benign	Het
Mrpl13	G	T	15: 55,548,219	H56Q	probably damaging	Het
Msr1	T	C	8: 39,624,222	T116A	probably benign	Het
N4bp3	T	C	11: 51,646,103	K48E	probably damaging	Het
Naaladl1	A	G	19: 6,106,195	T104A	probably benign	Het
Neu1	C	T	17: 34,932,766	R179W	probably damaging	Het
Olfr1053	A	T	2: 86,315,180	Y35*	probably null	Het
Olfr975	T	C	9: 39,950,334	T146A	probably benign	Het
Osbp	G	T	19: 11,973,834	E248*	probably null	Het
Otx1	T	A	11: 21,996,634		probably benign	Het
Parp4	A	T	14: 56,613,817	Q759L	probably damaging	Het
Pax6	A	C	2: 105,685,883	S169R	probably benign	Het
Pigg	T	G	5: 108,332,917	I389M	probably damaging	Het
Pla2g4a	C	A	1: 149,901,189	V59F	probably damaging	Het
Plcb4	A	T	2: 135,939,983	Q241H	probably benign	Het
Plpp6	A	G	19: 28,964,320	D107G	probably damaging	Het
Ppp6r2	T	A	15: 89,275,487	L459Q	probably damaging	Het
Prss55	A	T	14: 64,075,722	W238R	probably damaging	Het
Rgl1	C	T	1: 152,536,281	E446K	probably damaging	Het
Ric3	C	T	7: 109,038,883	G221D	probably damaging	Het
Rnf167	T	C	11: 70,649,303	F83S	probably damaging	Het
Ryr1	C	T	7: 29,098,777	V947M	probably damaging	Het
Scn1a	A	G	2: 66,288,968	L1397P	probably benign	Het
Sh3bp1	T	A	15: 78,918,319	V251E	possibly damaging	Het
Slc25a10	A	T	11: 120,497,074	I198L	probably benign	Het
Smoc2	A	T	17: 14,368,971	N234I	possibly damaging	Het
Spdl1	T	A	11: 34,819,309	K382*	probably null	Het
Ssrp1	G	A	2: 85,042,316		probably null	Het
Tril	G	T	6: 53,818,027	R737S	probably damaging	Het
Triqk	T	A	4: 12,974,817		probably null	Het
Ttc19	T	C	11: 62,283,693	Y128H	probably damaging	Het
Vmn1r15	T	C	6: 57,258,692	S182P	possibly damaging	Het
Vmn1r226	A	G	17: 20,688,213	I236V	probably damaging	Het
Vmn2r120	A	C	17: 57,509,479	N625K	probably damaging	Het
Vmn2r78	T	C	7: 86,920,154	I85T	probably damaging	Het
Wdr60	A	T	12: 116,229,571		probably null	Het
Whamm	C	T	7: 81,591,771	R277*	probably null	Het
Wnt7a	C	T	6: 91,394,486	V165I	probably benign	Het
Zbtb40	A	T	4: 136,985,017	Y1127N	possibly damaging	Het
Zfyve1	A	T	12: 83,547,931	H762Q	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCTCTGTCCCTAAACCATG -3'
(R):5'- TGTGTCAACTTCCACTGGGTC -3'

Sequencing Primer
(F):5'- TGTCCCTAAACCATGGCAGAGG -3'
(R):5'- AACTTCCACTGGGTCAAGCTCG -3'

Posted On

2014-10-30