Mutagenetix > Incidental Mutation

Incidental Mutation 'R5164:Cfap65'

395576

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

042745-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.524) question?

Stock #

R5164 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74926516 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 445 (K445R)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: K445R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: K445R

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Meta Mutation Damage Score

0.1727

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	A	T	13: 81,435,674	H4637Q	probably benign	Het
Akap6	A	G	12: 53,142,466	H2221R	probably benign	Het
Arsj	A	T	3: 126,438,159	M185L	probably benign	Het
Ccdc177	T	C	12: 80,758,562	T313A	unknown	Het
Cdkal1	A	T	13: 29,625,719	L214H	probably damaging	Het
Cfap44	T	A	16: 44,481,389	I1830N	probably damaging	Het
Chrnb3	T	A	8: 27,394,132	I299N	probably damaging	Het
Cse1l	C	A	2: 166,944,428	D826E	probably benign	Het
Cwf19l2	T	C	9: 3,475,511	V816A	probably damaging	Het
Dnah5	A	T	15: 28,408,292	E3474D	probably benign	Het
Dock5	A	T	14: 67,817,661	Y585*	probably null	Het
Ebf2	T	C	14: 67,390,521	S322P	possibly damaging	Het
Epha8	T	C	4: 136,945,672	E267G	possibly damaging	Het
Fam126b	T	C	1: 58,535,438	T315A	probably benign	Het
Fkbp5	A	G	17: 28,437,990		probably null	Het
Gbp4	T	A	5: 105,136,877	K49*	probably null	Het
Gm13212	T	C	4: 145,622,205	Y71H	probably damaging	Het
Gramd4	A	T	15: 86,100,831	T98S	probably benign	Het
H2-Ke6	A	G	17: 34,026,978		probably benign	Het
Hectd1	C	A	12: 51,827,489	M1I	probably null	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Keg1	A	G	19: 12,714,680		probably benign	Het
Lilra6	A	T	7: 3,914,881	V88E	probably damaging	Het
Mast1	A	G	8: 84,913,518		probably benign	Het
Mdn1	A	G	4: 32,759,011		probably null	Het
Nrd1	C	T	4: 109,039,717	T511I	probably damaging	Het
Olfr1058	T	C	2: 86,385,471	T316A	probably benign	Het
Olfr1204	T	A	2: 88,852,570	L207I	probably benign	Het
Olfr478	G	A	7: 108,032,280	T21I	possibly damaging	Het
Pms1	A	G	1: 53,207,640	V301A	probably damaging	Het
Pnisr	A	T	4: 21,859,237	Q144L	possibly damaging	Het
Pp2d1	G	T	17: 53,508,070	T542K	probably benign	Het
Ppargc1b	A	T	18: 61,302,644	C922S	probably damaging	Het
Ptprd	T	C	4: 76,100,758		probably null	Het
Runx3	T	C	4: 135,121,130	S9P	possibly damaging	Het
Serpina1b	A	G	12: 103,732,087	S168P	probably benign	Het
Slc14a2	G	A	18: 78,157,272	A722V	probably damaging	Het
Slc23a2	T	A	2: 132,075,450		probably benign	Het
Slc47a1	A	G	11: 61,353,060		probably null	Het
Tcf20	A	G	15: 82,856,603	S216P	probably damaging	Het
Tpst1	T	A	5: 130,102,001	I104N	probably damaging	Het
Ttc25	G	A	11: 100,571,520	W506*	probably null	Het
Ufm1	A	C	3: 53,857,927		probably benign	Het
Unkl	A	G	17: 25,213,109		probably null	Het
Usf3	T	C	16: 44,218,180	S1008P	probably damaging	Het
Ythdf3	T	C	3: 16,183,513	V6A	possibly damaging	Het
Zc3h3	A	T	15: 75,777,026	S752R	probably benign	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9187:Cfap65	UTSW	1	74917358	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGATCCCTTAGAGGTTCCGCAAG -3'
(R):5'- AAGGATCTCTCACAGGGACC -3'

Sequencing Primer
(F):5'- CAAGGAGGAGGGTGCCCAC -3'
(R):5'- TAGGTCCCGATGCAGTGCTG -3'

Posted On

2016-06-21