Mutagenetix > Incidental Mutation

Incidental Mutation 'R9187:Cfap65'

697411

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.621) question?

Stock #

R9187 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74917358 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 1021 (M1021L)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably benign
Transcript: ENSMUST00000094844
AA Change: M1021L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: M1021L

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

97% (70/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca5	A	G	11: 110,310,135		probably null	Het
Abcb1a	T	A	5: 8,715,016	C669S	probably benign	Het
Abcc3	A	G	11: 94,365,087	L524P	probably damaging	Het
Akap5	A	T	12: 76,329,971	K726*	probably null	Het
Aldh16a1	T	C	7: 45,142,017	E778G	probably damaging	Het
Ankle2	G	A	5: 110,252,744	V649M	possibly damaging	Het
Apon	A	G	10: 128,254,963	N170S	probably benign	Het
Baiap2l1	T	C	5: 144,280,954	Y274C	probably benign	Het
Bub1	A	T	2: 127,814,936	N425K	possibly damaging	Het
Camsap1	A	G	2: 25,930,016	C1487R	probably damaging	Het
Cd4	A	C	6: 124,867,688	V378G	probably damaging	Het
Cenpa	C	A	5: 30,667,036	P3Q	unknown	Het
Cfap44	T	C	16: 44,404,781		probably benign	Het
Ddx39	G	T	8: 83,722,484	M300I	probably benign	Het
Dgkh	T	C	14: 78,595,161	R819G	probably damaging	Het
Dlc1	A	T	8: 36,938,632	M1K	probably null	Het
Dnah9	A	G	11: 66,005,146	W2468R	probably benign	Het
Ebag9	A	T	15: 44,640,310	K177I	probably damaging	Het
Ehbp1	T	C	11: 22,151,184	I249V	probably damaging	Het
Fam171b	T	C	2: 83,880,021	V679A	probably damaging	Het
Gabbr2	G	A	4: 46,674,533	T818I	probably damaging	Het
Gcn1l1	T	C	5: 115,614,118	S2098P	probably damaging	Het
Glb1	T	C	9: 114,473,923	I609T	probably damaging	Het
Gm12355	A	G	11: 98,625,361	V62A	possibly damaging	Het
Gm5916	T	G	9: 36,120,724	H88P	probably benign	Het
Gm6205	T	C	5: 94,683,896	V254A	probably benign	Het
Gon4l	T	C	3: 88,879,311	S586P	probably benign	Het
Gzmg	T	A	14: 56,157,257	T185S	probably benign	Het
Hipk3	T	A	2: 104,446,591	D381V	probably damaging	Het
Hnrnpul2	C	A	19: 8,830,955	N681K	probably benign	Het
Hpdl	C	A	4: 116,821,175	G30C	probably damaging	Het
Iws1	G	A	18: 32,080,160	E214K	possibly damaging	Het
Krt82	C	A	15: 101,541,825	V479L	probably benign	Het
Lama4	G	A	10: 39,048,128		probably null	Het
Lamc1	C	A	1: 153,221,688	E1537*	probably null	Het
Mab21l3	G	A	3: 101,823,278	T215M	probably benign	Het
Magi3	C	A	3: 104,015,757	V1215F	possibly damaging	Het
Mical2	T	A	7: 112,303,590	C89*	probably null	Het
Mitf	T	A	6: 98,017,874	V427D	probably benign	Het
Muc4	T	C	16: 32,768,728	V753A		Het
Myo16	G	A	8: 10,442,233	R725H	unknown	Het
Ncapg2	T	A	12: 116,438,667	D706E	probably damaging	Het
Ndst1	T	C	18: 60,691,196	D803G	probably benign	Het
Neb	A	T	2: 52,206,103	V5065D	probably damaging	Het
Npm3	G	A	19: 45,749,502	R19*	probably null	Het
Ntrk3	A	C	7: 78,247,218	N690K	possibly damaging	Het
Olfr850	T	C	9: 19,477,870	I127V	probably benign	Het
Olfr855	T	C	9: 19,584,654	I39T	probably benign	Het
Olfr985	C	A	9: 40,127,590	V124L	possibly damaging	Het
P3h2	G	A	16: 26,105,436	A83V	probably benign	Het
Pdia2	A	G	17: 26,196,936	S362P	probably damaging	Het
Pmp22	C	T	11: 63,134,442	H34Y	probably benign	Het
Pmp22	T	C	11: 63,134,491	V50A	probably benign	Het
Ppfia4	T	C	1: 134,327,268	D283G	probably damaging	Het
Prss55	T	A	14: 64,077,082	Q213L	probably null	Het
Rgsl1	C	T	1: 153,793,867	E258K	possibly damaging	Het
Ripor2	T	C	13: 24,713,649	F777L	probably benign	Het
Rsf1	GGC	GGCGGCGGCCGC	7: 97,579,933		probably benign	Het
Sgce	G	A	6: 4,711,362	R173C	probably benign	Het
Sncaip	T	G	18: 52,906,939	M735R	probably benign	Het
Snrpd2	T	A	7: 19,152,580	I96N	probably damaging	Het
Spryd3	T	G	15: 102,130,675	D121A	probably damaging	Het
Sspo	T	C	6: 48,495,289	C149R	probably damaging	Het
Tbc1d10b	A	T	7: 127,207,933	M144K	probably benign	Het
Tbc1d31	T	A	15: 57,916,089	I66N	probably damaging	Het
Tssk1	A	G	16: 17,894,593	T81A	possibly damaging	Het
Ttc28	A	G	5: 111,102,036	Y284C	probably damaging	Het
Ttn	T	C	2: 76,743,411	T25713A	probably benign	Het
Vmn2r125	T	C	4: 156,351,259	W311R	probably damaging	Het
Vmn2r80	A	T	10: 79,194,604	T755S	probably benign	Het
Vmn2r98	T	C	17: 19,081,219	C828R	probably damaging	Het
Wwox	T	C	8: 114,712,238	F348S	probably damaging	Het
Zeb2	T	A	2: 45,110,028	R65W	possibly damaging	Het
Zfp712	T	A	13: 67,040,573	H630L	probably damaging	Het
Zfp764	G	T	7: 127,405,436	H174Q	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74931918	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74910743	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74903223	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74902188	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74920393	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74904688	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74919351	splice site	probably benign
R9210:Cfap65	UTSW	1	74920408	missense	probably benign
R9212:Cfap65	UTSW	1	74920408	missense	probably benign
R9273:Cfap65	UTSW	1	74921610	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74905051	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74906309	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74907378	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74919342	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74904681	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCTTACCTGTGCCGAGTG -3'
(R):5'- AAATGCCAGGATCTACGTTAAGAC -3'

Sequencing Primer
(F):5'- AGGTGAGCTCCTTGGCAG -3'
(R):5'- TCTACGTTAAGACAGGACAGTGCC -3'

Posted On

2022-02-07