Incidental Mutation 'R9187:Cfap65'
ID 697411
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock # R9187 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 74917358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1021 (M1021L)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: M1021L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: M1021L

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A G 11: 110,310,135 probably null Het
Abcb1a T A 5: 8,715,016 C669S probably benign Het
Abcc3 A G 11: 94,365,087 L524P probably damaging Het
Akap5 A T 12: 76,329,971 K726* probably null Het
Aldh16a1 T C 7: 45,142,017 E778G probably damaging Het
Ankle2 G A 5: 110,252,744 V649M possibly damaging Het
Apon A G 10: 128,254,963 N170S probably benign Het
Baiap2l1 T C 5: 144,280,954 Y274C probably benign Het
Bub1 A T 2: 127,814,936 N425K possibly damaging Het
Camsap1 A G 2: 25,930,016 C1487R probably damaging Het
Cd4 A C 6: 124,867,688 V378G probably damaging Het
Cenpa C A 5: 30,667,036 P3Q unknown Het
Ddx39 G T 8: 83,722,484 M300I probably benign Het
Dgkh T C 14: 78,595,161 R819G probably damaging Het
Dlc1 A T 8: 36,938,632 M1K probably null Het
Dnah9 A G 11: 66,005,146 W2468R probably benign Het
Ebag9 A T 15: 44,640,310 K177I probably damaging Het
Ehbp1 T C 11: 22,151,184 I249V probably damaging Het
Fam171b T C 2: 83,880,021 V679A probably damaging Het
Gabbr2 G A 4: 46,674,533 T818I probably damaging Het
Gcn1l1 T C 5: 115,614,118 S2098P probably damaging Het
Glb1 T C 9: 114,473,923 I609T probably damaging Het
Gm12355 A G 11: 98,625,361 V62A possibly damaging Het
Gm5916 T G 9: 36,120,724 H88P probably benign Het
Gm6205 T C 5: 94,683,896 V254A probably benign Het
Gon4l T C 3: 88,879,311 S586P probably benign Het
Gzmg T A 14: 56,157,257 T185S probably benign Het
Hipk3 T A 2: 104,446,591 D381V probably damaging Het
Hnrnpul2 C A 19: 8,830,955 N681K probably benign Het
Hpdl C A 4: 116,821,175 G30C probably damaging Het
Iws1 G A 18: 32,080,160 E214K possibly damaging Het
Krt82 C A 15: 101,541,825 V479L probably benign Het
Lama4 G A 10: 39,048,128 probably null Het
Lamc1 C A 1: 153,221,688 E1537* probably null Het
Mab21l3 G A 3: 101,823,278 T215M probably benign Het
Magi3 C A 3: 104,015,757 V1215F possibly damaging Het
Mical2 T A 7: 112,303,590 C89* probably null Het
Mitf T A 6: 98,017,874 V427D probably benign Het
Muc4 T C 16: 32,768,728 V753A Het
Myo16 G A 8: 10,442,233 R725H unknown Het
Ncapg2 T A 12: 116,438,667 D706E probably damaging Het
Ndst1 T C 18: 60,691,196 D803G probably benign Het
Neb A T 2: 52,206,103 V5065D probably damaging Het
Npm3 G A 19: 45,749,502 R19* probably null Het
Ntrk3 A C 7: 78,247,218 N690K possibly damaging Het
Olfr850 T C 9: 19,477,870 I127V probably benign Het
Olfr855 T C 9: 19,584,654 I39T probably benign Het
Olfr985 C A 9: 40,127,590 V124L possibly damaging Het
P3h2 G A 16: 26,105,436 A83V probably benign Het
Pdia2 A G 17: 26,196,936 S362P probably damaging Het
Pmp22 C T 11: 63,134,442 H34Y probably benign Het
Pmp22 T C 11: 63,134,491 V50A probably benign Het
Ppfia4 T C 1: 134,327,268 D283G probably damaging Het
Prss55 T A 14: 64,077,082 Q213L probably null Het
Rgsl1 C T 1: 153,793,867 E258K possibly damaging Het
Ripor2 T C 13: 24,713,649 F777L probably benign Het
Rsf1 GGC GGCGGCGGCCGC 7: 97,579,933 probably benign Het
Sgce G A 6: 4,711,362 R173C probably benign Het
Sncaip T G 18: 52,906,939 M735R probably benign Het
Snrpd2 T A 7: 19,152,580 I96N probably damaging Het
Spryd3 T G 15: 102,130,675 D121A probably damaging Het
Sspo T C 6: 48,495,289 C149R probably damaging Het
Tbc1d10b A T 7: 127,207,933 M144K probably benign Het
Tbc1d31 T A 15: 57,916,089 I66N probably damaging Het
Tssk1 A G 16: 17,894,593 T81A possibly damaging Het
Ttc28 A G 5: 111,102,036 Y284C probably damaging Het
Ttn T C 2: 76,743,411 T25713A probably benign Het
Vmn2r125 T C 4: 156,351,259 W311R probably damaging Het
Vmn2r80 A T 10: 79,194,604 T755S probably benign Het
Vmn2r98 T C 17: 19,081,219 C828R probably damaging Het
Wwox T C 8: 114,712,238 F348S probably damaging Het
Zeb2 T A 2: 45,110,028 R65W possibly damaging Het
Zfp712 T A 13: 67,040,573 H630L probably damaging Het
Zfp764 G T 7: 127,405,436 H174Q probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74926633 missense probably benign 0.01
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
R8344:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8345:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8413:Cfap65 UTSW 1 74917169 nonsense probably null
R8431:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8432:Cfap65 UTSW 1 74928044 missense probably benign 0.01
R8528:Cfap65 UTSW 1 74905937 missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74903223 missense probably benign 0.43
R8996:Cfap65 UTSW 1 74902188 missense probably benign 0.11
R9020:Cfap65 UTSW 1 74920393 missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74904688 missense possibly damaging 0.88
R9210:Cfap65 UTSW 1 74920408 missense probably benign
R9212:Cfap65 UTSW 1 74920408 missense probably benign
R9273:Cfap65 UTSW 1 74921610 missense probably benign 0.00
R9454:Cfap65 UTSW 1 74905051 missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74906309 critical splice donor site probably null
R9595:Cfap65 UTSW 1 74907378 missense probably damaging 1.00
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTTACCTGTGCCGAGTG -3'
(R):5'- AAATGCCAGGATCTACGTTAAGAC -3'

Sequencing Primer
(F):5'- AGGTGAGCTCCTTGGCAG -3'
(R):5'- TCTACGTTAAGACAGGACAGTGCC -3'
Posted On 2022-02-07