Incidental Mutation 'R0226:Greb1l'
ID33968
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 038471-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0226 (G1)
Quality Score199
Status Validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 10522076 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172532
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172680
SMART Domains Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

DomainStartEndE-ValueType
low complexity region 116 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (98/98)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik G T 14: 59,142,120 T54K possibly damaging Het
2210408I21Rik A T 13: 77,303,425 E876V possibly damaging Het
Aasdh A T 5: 76,902,002 L49Q probably damaging Het
Abca8b T C 11: 109,957,018 probably null Het
Ablim1 A T 19: 57,043,870 L556Q probably damaging Het
Afdn A G 17: 13,899,146 T1700A probably benign Het
Agl G A 3: 116,752,071 R1359C probably damaging Het
Agpat3 T A 10: 78,278,029 H275L possibly damaging Het
Ahcyl1 A T 3: 107,670,270 C180* probably null Het
Aim2 A G 1: 173,462,333 probably benign Het
Angpt1 T C 15: 42,468,235 N320S probably benign Het
Ankrd52 T A 10: 128,389,858 probably null Het
Ap1g1 C T 8: 109,855,062 S654L probably benign Het
Bpifa1 T A 2: 154,146,057 S173R probably benign Het
Brd8 T C 18: 34,603,894 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
C1qtnf2 A G 11: 43,490,843 T161A probably benign Het
Car6 T C 4: 150,187,508 Y228C probably damaging Het
Ccdc149 A G 5: 52,400,217 L273P probably damaging Het
Cit G A 5: 115,984,840 R1405Q probably damaging Het
Cox17 T C 16: 38,349,276 L48P probably damaging Het
Cttn A G 7: 144,441,852 probably benign Het
Cyp4f18 T C 8: 71,989,775 probably benign Het
Dtnbp1 A G 13: 44,923,193 L175P probably damaging Het
Efl1 T C 7: 82,693,011 probably benign Het
Fbn1 C T 2: 125,320,910 R2152Q possibly damaging Het
Fignl1 A T 11: 11,801,061 S665T probably benign Het
Gm884 A T 11: 103,603,241 F663L probably benign Het
Gm9843 A T 16: 76,403,561 noncoding transcript Het
Gpr155 C T 2: 73,367,592 V395I probably benign Het
Hdgfl1 A T 13: 26,769,996 H31Q probably benign Het
Heatr1 T C 13: 12,410,562 S628P probably damaging Het
Hivep2 A G 10: 14,129,712 T685A probably benign Het
Hmgcl T G 4: 135,958,728 V168G probably damaging Het
Itch T C 2: 155,199,394 I454T probably benign Het
Itih2 T C 2: 10,115,299 D309G possibly damaging Het
Kcmf1 T C 6: 72,842,952 I304V probably benign Het
Kcnh1 G T 1: 192,276,805 W222C probably damaging Het
Kcnh1 G A 1: 192,276,804 W222* probably null Het
Kif24 T A 4: 41,414,939 K287* probably null Het
Lrig3 A G 10: 125,972,117 probably benign Het
Lrp2 A T 2: 69,537,563 C202S probably null Het
Lrrn2 A G 1: 132,937,820 N208D probably damaging Het
Mcm5 C T 8: 75,126,252 T664I possibly damaging Het
Mfsd10 A G 5: 34,634,446 L365S probably benign Het
Mfsd6 A G 1: 52,658,690 probably benign Het
Mgat4e A G 1: 134,541,103 V401A probably benign Het
Mllt3 C A 4: 87,840,732 V360L probably benign Het
Mrm1 G A 11: 84,819,170 A68V possibly damaging Het
Myo19 A G 11: 84,897,732 probably benign Het
Myo3b A G 2: 70,217,166 T311A probably benign Het
Myo5b T C 18: 74,742,180 F1552L probably benign Het
Myo7b C T 18: 31,972,896 V1353I probably benign Het
Myo9b T C 8: 71,353,832 S1512P probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Osbpl3 A G 6: 50,353,008 W63R probably damaging Het
Pcdh17 T C 14: 84,448,201 S703P probably damaging Het
Pclo T C 5: 14,765,223 I1231T probably damaging Het
Pex16 A C 2: 92,375,687 probably benign Het
Pfkl T C 10: 77,992,534 N399S probably benign Het
Pkhd1l1 G A 15: 44,526,784 R1432K possibly damaging Het
Prdm1 T A 10: 44,456,696 T106S probably benign Het
Prrc1 A G 18: 57,363,291 M105V probably benign Het
Psg26 A G 7: 18,483,958 C12R possibly damaging Het
Rnf43 A T 11: 87,731,437 S455C probably damaging Het
Ryr2 T C 13: 11,772,556 K977R probably damaging Het
Sart1 C T 19: 5,381,122 probably benign Het
Sec14l5 A G 16: 5,180,303 S509G probably benign Het
Sin3b A T 8: 72,744,508 E361V probably benign Het
Slc35e3 C T 10: 117,740,890 E179K possibly damaging Het
Sntb2 T C 8: 107,001,583 S388P probably damaging Het
Srms A G 2: 181,212,382 S131P probably benign Het
Stxbp5 T C 10: 9,866,698 probably benign Het
Taar2 G A 10: 23,941,495 R311H probably benign Het
Taar2 T C 10: 23,941,063 V167A probably damaging Het
Thsd7a A G 6: 12,321,900 Y1516H possibly damaging Het
Tlk1 T A 2: 70,714,169 probably benign Het
Tmem173 A T 18: 35,739,088 F120L probably benign Het
Tnfaip3 T C 10: 19,002,747 K771R probably damaging Het
Treml1 C T 17: 48,360,458 L124F probably damaging Het
Ttn G T 2: 76,780,797 Q9137K possibly damaging Het
Unkl T A 17: 25,230,711 I469N probably damaging Het
Vmn1r173 G T 7: 23,703,083 V248L possibly damaging Het
Vps35 T C 8: 85,273,575 Q474R probably damaging Het
Wdr17 T A 8: 54,663,008 T580S probably benign Het
Xpnpep1 T C 19: 53,010,152 K222E probably benign Het
Ylpm1 A G 12: 85,049,737 T1446A probably benign Het
Zfp277 A G 12: 40,364,162 L228S possibly damaging Het
Zfp941 T A 7: 140,813,275 K57M probably damaging Het
Zmpste24 A T 4: 121,081,209 S244R probably benign Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R1967:Greb1l UTSW 18 10501049 missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7915:Greb1l UTSW 18 10542056 missense probably benign 0.38
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCAGGCCGTGAGACGTGGAATG -3'
(R):5'- ACCAGCACAAACAGTGTGTATGGG -3'

Sequencing Primer
(F):5'- AAAGGGAAGTCTGACGTTTCCTC -3'
(R):5'- CACAAACAGTGTGTATGGGTTCTG -3'
Posted On2013-05-09