Mutagenetix > Incidental Mutation

Incidental Mutation 'R0226:Greb1l'

33968

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

038471-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0226 (G1)

Quality Score

199

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 10522076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

AlphaFold

B9EJV3

Predicted Effect

probably benign
Transcript: ENSMUST00000048977

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (98/98)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 90 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700129C05Rik	G	T	14: 59,142,120	T54K	possibly damaging	Het
2210408I21Rik	A	T	13: 77,303,425	E876V	possibly damaging	Het
Aasdh	A	T	5: 76,902,002	L49Q	probably damaging	Het
Abca8b	T	C	11: 109,957,018		probably null	Het
Ablim1	A	T	19: 57,043,870	L556Q	probably damaging	Het
Afdn	A	G	17: 13,899,146	T1700A	probably benign	Het
Agl	G	A	3: 116,752,071	R1359C	probably damaging	Het
Agpat3	T	A	10: 78,278,029	H275L	possibly damaging	Het
Ahcyl1	A	T	3: 107,670,270	C180*	probably null	Het
Aim2	A	G	1: 173,462,333		probably benign	Het
Angpt1	T	C	15: 42,468,235	N320S	probably benign	Het
Ankrd52	T	A	10: 128,389,858		probably null	Het
Ap1g1	C	T	8: 109,855,062	S654L	probably benign	Het
Bpifa1	T	A	2: 154,146,057	S173R	probably benign	Het
Brd8	T	C	18: 34,603,894		probably benign	Het
Btbd9	C	T	17: 30,274,942	D492N	possibly damaging	Het
C1qtnf2	A	G	11: 43,490,843	T161A	probably benign	Het
Car6	T	C	4: 150,187,508	Y228C	probably damaging	Het
Ccdc149	A	G	5: 52,400,217	L273P	probably damaging	Het
Cit	G	A	5: 115,984,840	R1405Q	probably damaging	Het
Cox17	T	C	16: 38,349,276	L48P	probably damaging	Het
Cttn	A	G	7: 144,441,852		probably benign	Het
Cyp4f18	T	C	8: 71,989,775		probably benign	Het
Dtnbp1	A	G	13: 44,923,193	L175P	probably damaging	Het
Efl1	T	C	7: 82,693,011		probably benign	Het
Fbn1	C	T	2: 125,320,910	R2152Q	possibly damaging	Het
Fignl1	A	T	11: 11,801,061	S665T	probably benign	Het
Gm884	A	T	11: 103,603,241	F663L	probably benign	Het
Gm9843	A	T	16: 76,403,561		noncoding transcript	Het
Gpr155	C	T	2: 73,367,592	V395I	probably benign	Het
Hdgfl1	A	T	13: 26,769,996	H31Q	probably benign	Het
Heatr1	T	C	13: 12,410,562	S628P	probably damaging	Het
Hivep2	A	G	10: 14,129,712	T685A	probably benign	Het
Hmgcl	T	G	4: 135,958,728	V168G	probably damaging	Het
Itch	T	C	2: 155,199,394	I454T	probably benign	Het
Itih2	T	C	2: 10,115,299	D309G	possibly damaging	Het
Kcmf1	T	C	6: 72,842,952	I304V	probably benign	Het
Kcnh1	G	A	1: 192,276,804	W222*	probably null	Het
Kcnh1	G	T	1: 192,276,805	W222C	probably damaging	Het
Kif24	T	A	4: 41,414,939	K287*	probably null	Het
Lrig3	A	G	10: 125,972,117		probably benign	Het
Lrp2	A	T	2: 69,537,563	C202S	probably null	Het
Lrrn2	A	G	1: 132,937,820	N208D	probably damaging	Het
Mcm5	C	T	8: 75,126,252	T664I	possibly damaging	Het
Mfsd10	A	G	5: 34,634,446	L365S	probably benign	Het
Mfsd6	A	G	1: 52,658,690		probably benign	Het
Mgat4e	A	G	1: 134,541,103	V401A	probably benign	Het
Mllt3	C	A	4: 87,840,732	V360L	probably benign	Het
Mrm1	G	A	11: 84,819,170	A68V	possibly damaging	Het
Myo19	A	G	11: 84,897,732		probably benign	Het
Myo3b	A	G	2: 70,217,166	T311A	probably benign	Het
Myo5b	T	C	18: 74,742,180	F1552L	probably benign	Het
Myo7b	C	T	18: 31,972,896	V1353I	probably benign	Het
Myo9b	T	C	8: 71,353,832	S1512P	probably damaging	Het
Nanos3	C	T	8: 84,176,134	R133Q	probably damaging	Het
Osbpl3	A	G	6: 50,353,008	W63R	probably damaging	Het
Pcdh17	T	C	14: 84,448,201	S703P	probably damaging	Het
Pclo	T	C	5: 14,765,223	I1231T	probably damaging	Het
Pex16	A	C	2: 92,375,687		probably benign	Het
Pfkl	T	C	10: 77,992,534	N399S	probably benign	Het
Pkhd1l1	G	A	15: 44,526,784	R1432K	possibly damaging	Het
Prdm1	T	A	10: 44,456,696	T106S	probably benign	Het
Prrc1	A	G	18: 57,363,291	M105V	probably benign	Het
Psg26	A	G	7: 18,483,958	C12R	possibly damaging	Het
Rnf43	A	T	11: 87,731,437	S455C	probably damaging	Het
Ryr2	T	C	13: 11,772,556	K977R	probably damaging	Het
Sart1	C	T	19: 5,381,122		probably benign	Het
Sec14l5	A	G	16: 5,180,303	S509G	probably benign	Het
Sin3b	A	T	8: 72,744,508	E361V	probably benign	Het
Slc35e3	C	T	10: 117,740,890	E179K	possibly damaging	Het
Sntb2	T	C	8: 107,001,583	S388P	probably damaging	Het
Srms	A	G	2: 181,212,382	S131P	probably benign	Het
Stxbp5	T	C	10: 9,866,698		probably benign	Het
Taar2	T	C	10: 23,941,063	V167A	probably damaging	Het
Taar2	G	A	10: 23,941,495	R311H	probably benign	Het
Thsd7a	A	G	6: 12,321,900	Y1516H	possibly damaging	Het
Tlk1	T	A	2: 70,714,169		probably benign	Het
Tmem173	A	T	18: 35,739,088	F120L	probably benign	Het
Tnfaip3	T	C	10: 19,002,747	K771R	probably damaging	Het
Treml1	C	T	17: 48,360,458	L124F	probably damaging	Het
Ttn	G	T	2: 76,780,797	Q9137K	possibly damaging	Het
Unkl	T	A	17: 25,230,711	I469N	probably damaging	Het
Vmn1r173	G	T	7: 23,703,083	V248L	possibly damaging	Het
Vps35	T	C	8: 85,273,575	Q474R	probably damaging	Het
Wdr17	T	A	8: 54,663,008	T580S	probably benign	Het
Xpnpep1	T	C	19: 53,010,152	K222E	probably benign	Het
Ylpm1	A	G	12: 85,049,737	T1446A	probably benign	Het
Zfp277	A	G	12: 40,364,162	L228S	possibly damaging	Het
Zfp941	T	A	7: 140,813,275	K57M	probably damaging	Het
Zmpste24	A	T	4: 121,081,209	S244R	probably benign	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5290:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
R8886:Greb1l	UTSW	18	10553843	missense	probably benign	0.21
R8921:Greb1l	UTSW	18	10541825	missense	probably benign	0.01
R8997:Greb1l	UTSW	18	10510747	missense	probably damaging	1.00
R9015:Greb1l	UTSW	18	10541675	missense	probably benign	0.00
R9018:Greb1l	UTSW	18	10542004	missense	possibly damaging	0.76
R9074:Greb1l	UTSW	18	10532797	missense	probably damaging	1.00
R9074:Greb1l	UTSW	18	10558795	missense	probably damaging	1.00
R9117:Greb1l	UTSW	18	10542422	missense	probably benign	0.31
R9189:Greb1l	UTSW	18	10499983	missense	probably benign
R9332:Greb1l	UTSW	18	10532796	missense	possibly damaging	0.92
R9367:Greb1l	UTSW	18	10522130	missense	probably benign	0.00
R9497:Greb1l	UTSW	18	10458600	missense	probably benign	0.00
R9796:Greb1l	UTSW	18	10538233	missense	possibly damaging	0.69
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATCAGGCCGTGAGACGTGGAATG -3'
(R):5'- ACCAGCACAAACAGTGTGTATGGG -3'

Sequencing Primer
(F):5'- AAAGGGAAGTCTGACGTTTCCTC -3'
(R):5'- CACAAACAGTGTGTATGGGTTCTG -3'

Posted On

2013-05-09